%PDF-1.3 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream 2021-06-29T16:37:42+01:00 2021-06-29T16:37:42+01:00 2021-06-29T16:37:42+01:00 Adobe Illustrator 25.1 (Macintosh) 184 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAC4AwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqtkkSONpHNEQFm PWgAqemQyTEImUuQFlIBJoIH9P6R/v8A/wCEf/mnNZ/Lmk/n/ZL9TkflMnd9zv0/pH+//wDhH/5p x/lzSfz/ALJfqX8pk7vuTDNs4zsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVQ+o /wDHPuv+MT/8ROYmv/xfJ/Ul9xbMP1j3h4do/mDzjrl9qNpaXNhZGxnuCsk1jPOrQLf3VlClVvIP 3i/o9nkboeagKvGrcNlwYccQSJGwP4gN+GMj/CdvUAB5Hd28ZykSBXy867/Ju183a/cadaeYlksX 0W5voNP/AEfFFJJITNerpxmiv/WEckXqt60bfVhzjoPhJ5BnpcYkcfq4xEyvbpEyrhq7rY+raXuU ZDz2q/2c/wBnJ7wOmehh0jsKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KqF+rNY3 CqCzNE4VRuSSp2GY2tiZYJgbkwl9zZiNTHveaXH5daFdQJBe+Xob2KOa4uIlu7YXPCW8lM9wyGZX K+pIxJA27dAM4SOPWxNiOQbAbCQ5Chy7g7cyxHmYobVvI2nHXLTXh5Ymuda9ZI21G0RYZ41PCs00 heBnRFhVGpzbgWQKUZ1NmLDq+A46mIVyMZEe4bHffyF78wCiUsdg2L94etjpnoAdK7FXYq7FXYq7 FXYqwLzV+Zms6Hrl5p8HlS+1C0tY4niv4xIEuZZSoMFvxhkVpE9RTuwBHKh5LxKrMtHv5NQ0myvp baSzluoI5pLSYFZYWdQzRuCB8SE0O2KsY84eftT8u6ikEPly91a1Kwl57NZGceqzhmA9Mw8Iwnxl plNWHw0+LFUHqH5m6vB+khaeUtSufqcNtPauySIk4uI1kdKrFKVePmFoob4q8uNCcVQCfnPqMtyn o+R/MH1JpoYmmks5I5AkkYZpPSZekbuqNv8AzeABVZ55g1O50zSZr21tGvp42jVbdeYr6kqxl2Ma TOEjDc3Kox4g7Yqw7TfzO8x3WtRWFx5OvoLaW7gtmvFMriKOeMs0sqtbxUELlI34sVqSQxVScVeh Yq881z8y/NGn6pcWVp5Pur6OGQJHKpuh6gNyIKgpZyxV4H1/7ynp7lg3w4q9CRg6hhWjAEVBB39j viqWeZ9W1HStGlvdN019XvVkgjisI29Nn9adImbnxfiI1cuxIpQb064qwhfzqnZ2UeRvMwCKrOzW NAC0vpcftmpGzbdvkcVZj5X8xza/p0t42lXuktHKYkttRjEMrjgjhwAX+E86exBHbFWBN+cvnLnA B+XmpJ6kkkcokaZWjVUEiSfDbOGWRXAHE8uQZaVXdV6fp9zLc2FvcSxiKWaNHeNS5CsygkAyJC+3 +UinxAxVEYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq 7FXYq7FWP+fvNU/lXypd65b2P6Tnt3t4obH1RB6j3NzHbqPVKyBaGWu4yzFDikAxnLhFsW0384/0 3FaDy/pkV3c6lqh07To7m6a3R4U0xNSe5kdYJzGVWQIY+JNe/bJnDXM9P00xGS+SKuvzXaL8trrz fFo8kuoWNytheaF6wDrefXEs5IVnVHV+LvVWC/F7dkYRxAXsRd+VWvHty35JXY/nzpmsR6pLoGnG 8itp9ItNJlnle1W9n1edoKbwu0SwPG4LUblxNO1ZHTGNcXn9iBlvkgPNX/OQb+WoJIdQ0KKPV7S8 uLK/tGvm9FDDAtzDJFOts5kFxG44AxqQdmphhpuLkdiP00sstcwm8f5v35inuJNEhW2TyqPNkTJf M7snpBjbMv1cKp9TkvMM2wDU34geAO/+LhXxPLpaN/ND81ovIt5o1tJawT/pgXHCW5uJoEVrdoVC D0LW9Zi/r13CgceuRwYPEvy/HeE5MnCln5p/nZJ5F1ptNTR4dQEemrqjyy3wtGZWuvqvpRIYZvUe pD0r9mvhhw4OMc+vcs58KKX87NEbzx/gz6vTWxqx070Ocn+8gtfrH13l6Xp/3n7r0ufL9qtMRpyY 8XSlOSjSVXv57ahpelWOpax5bW1g1vS7jVtAWO+EzTrbRrOYp6QL6DNA4evxjt1yX5YG6PIgH47I 8TyVtV/PqzsdCvNSGmIZ9MTTk1S2kuXT6rd3tzc2tzbyskEr/wCiPZmrKh5g1UdKgac2BfO/utfF 2Pkqw/nbFLr/AJc0c2ljE/mG0s7y3lkvbhA63lxJCVtuVkFkZEiD8ZWiLFgqiuJ0+xO+3471GXl5 vUcxm12KuxV2KuxV2KuxV2KuxV2KuxVIPPKeWJPLssfmW5FrpJmt3klLFKSQTpPF8QB/3ZEK+2WY jIS9PNjMAjfkxG98v/lUi3+kRatLpt9deYPrDT2V1JBdwazqEJX04ZE3T1oQy8fs0J+iyJnsasV9 gYnh5Kx8yfk5pXk3RbX9MW1r5fmmjuNMnDsPXn0y6jnaRnC8nf6wimUtuxJr1x4Mhkdt/wBaLiBz Udb1X8lpbu80i51e3sLu9sLSb07WVrZoYbN5dQtZ4GjCiKZWuWmWh5HY0I6ojk51y/sTxR+aD1Xy 7+UVhptnFe69dWU+nwnWzq6Xs0V/NHqDi1+tXF0gEknqlhFUnp8PTJA5CeXlXTvY+nv80F6P5Bab BHef4hFvYa7pUmhWkBvJDB9QANvII4zX0xzjYmRtjJyavInJXlO1bg2ioDqzCX8p9Iljtg2t699Y tDP6N6NVufrPC69H1IjNy5mOtsjBK0rvlPjnuHybPDHeU/fyro7+bE81NGzavHYnTUctVBAZfW2X +bn+14ZXxmq6Mq3tDL5F0AXn1sJJ636WOu15mn1w2v1StP5fS/Z8d8kMhArypBiCky/k35N+r39t P9bura7he0tobm4eZLC2lFHhsA9fq6MAFovYAdMl48vx196PDCL1X8q/KGoz6ncejLZXOrzWd1eT 2UrW8huLB3kgnVkoVkDSElhudj1yMcshXl+lJiHP+Wmky3ul3Nxqmr3Mel+ky2c+oTyW88tvL60M 1zGx/eyRyBWDH+Va1ph8Y77DfyRwMuypm7FXYq7FXYq7FXYq7FXYq7FXYqkvnTQZtf8AK2qaNC0S SX9pc2ySTKWVWnt5IkbapXizg1p0rkoSog9yCLFPI/Lv5Cea9KWS8fU7VtYn067klnSSXiddc3SW d3yMXLhFBfMOVOYYCgzKnqYk8tv0bX9zTHEQB+PcjbX8k/Ndld21vb6hp76JZa9oms2luiSWoSPT oWhu6QqsyiSUCMj4/jIJYrglqAem9H7UjER9icX/AJD89Q6f5u0PSV0qbSvM13e3gv76e4FzH9ft wjoYY7dkJjlHwP6uyAfDXIDJHYm7iGVGzXVjmt/kH5jmguY9O1GOU3Gg6fphN/e3krLd2mow3cvp yMkrRQenDSMJ0b9kdcujqo9R/Ff2FqOE18KRXmn8qfzD1MafeaRcwaP5gtLNbM6zHrWpSz+mLuSZ oJmktmN1CUZWAcoQ/XkqgGMM8Bz3HdQZHHL8F7VmG3uxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2 KuxV2KsO/N2DX5/y/wBQg0CS8h1SWWySGbTjILpEa9hErRmL49ouRan7Na7ZdgrjF8v2MMl8Jp5Z rOk/nfbX+rDUb+/1G8v7LTpkTSnvILGCU6qkUsEEsCgofqkfKV1QMFZiQRucmJxGqHXr/VP6Wk8e /u/SE71bTfOOjR2Fi9xrWoa6mo213b/UpNWubSOwn1FS1ibwEW8zQQo/qS30dSjD2pGJiTe1V5c6 51+plIEDzZWmq+YdfPnK68tysk9rPFoFhFPIY4llsmJvLuIlZUWSt2yD4CC0K8tthRwgcPF7/wAf L7Wyybpj5i8/r+RV3b+nqa+Zku5Y7cevdSag0I1ai/vwouOP1fYOP91/F0NMn6fEHKtvuYm+E96M 0xvNfk3VtOfX5NT1TT7mPV2Fpp66hrSWnqT2LWcEs5jM8xVEnKSzICOTKNhunhmNqvbuHeosHf8A Wlvl6fz5r3mnVZ9Qh17RtC8221/bWAk5oNOa1EUNpMqc/UtJJFSaQ8god2WnLrhkIiIGxlGvx59F F8XWil8Mn5i3f5d6HrOuPrCa1qusvLrNnBBqcb21tDZ3NtFH9V054LlInkhilPAqC78jUZM8AmQK oDy7x3sfVVldFH57i85W2oxpraaBHqekx+t6mqysLRtKT1kOmT81aJ7naaaR2ljatQWqcJ4OGtro 93f3sfVfWtu9OPybufNn6YvLfWoNUu42tfrA1zURqlpWSSXa2ksL4tbJMoqS1ofTUfDkM4jW1e7b 7+fzZ47vd61mI3OxV2KuxV2KuxV2KuxV2KuxV2KuxV2Kpfrt/e2NgZ7OFbi49RFSFiRy5MAQCP2i OnviqUWnmq7udR0+Nfq4trqOJmhPIXLmZGcSQrWhiXiORI/m8MNItCJ5w1mSTVE9C3t4rW8NpbX1 x6iWy8XkDGZyQPsxgDiftMAeuNKpXXm7zNDZS3qwWTQx29ncBf3nIi8kMS0JZV2ZCa1G1MaVEJ5s 1qQvGLe3SU26z27MXKsVto551biT9kygCh74qoxedNYW19S4S0kubi1tZbG1g9Qu016W9NGBYmiK nJ6D5YEp7p+vLqMmow2csDTw8WsQzfbSS3jlWRwDy485aVGEhALGZ/P+uWqWss9nBMk1gL90h5cv 3nqFAOTVooQF6KaCuNKCmlv5q1Aahb2MqwXvrCAve2VWt19aaWMglnJG0Yp13rhpbS6L8w766S0i hghsp7iNWmuL7nHbxv6bSEEgj4ZF4mM16eONLa6H8wby406SZIILa5+tzQAXJZY4Y4ojKvr0NQ8n Eovv8qYCKSFGb8xdRLcooLe2Bt3lW2uRJ6paO2FyTVaLxblxSvXr7Y0qNbzlqMcUrs1jLO5+r2Vh Ezm5a45rGHZKn90+8gpvw49a4kKEwsvNX120vmiMMV4iwmyt5WoS1xbxPGJFBrT1pwhp+vEhCCvv N+sWmrpYGzSRHl9D1VD0EnrBqHf/AJZGWT5+2DolAaJ+YWq3mr2FndW9vHDdqGd0LFl5MUQbM/Vq ffvTJUi2fZFLsVdirsVdirsVdiqVeZ9Wl0rSWvI2RSskaF5F5qFdwpPHnDXY/wA4xVjMX5h3qJcP c2yyQpPJDbXEKHhKViBVOPqOVdpJE70oT4Vw0i117571KG4SCNbdpY7KWW6Qo9Rc28dz6oX94rcF ltlH2Tseo2xpbVdS8+ql6iWN1bG1e1WdJHjL8n5SrJv60RCp6QNAjfMdcSFBRV15rvLfy9a6mWhc zXEsRkSM0kiUyiN4YpJYyS/BTx9TfeldsUoUectVWekiRBIGrqMRglWS2hFxFGryEuR8cLtINtqd 6HEhQgrTz55jdVNxaQI7RKyxFJFLyypO8MakyMwaT0V4jjvvuDxBaQrx+e7t9VNpDdWdzbmzkuYZ 1gmjDyIjnieUjMApj34q57bHokKCmR81zNo1vqQeO3t5Lowy3csJeNIxGx58YZnDAyqEBElN/HGl V/L2t6vqAu5b6OO1ht0jBHpkcJWt4pn5s0vL4TIfh4D/AFsCUql876pHp0V16MMnr2K3KSorems4 t5Znjf460rGAvyavbCAglUn81a7atDHOsH1iaGGaG3MDq0od3E3FknlUCGNQ5qenhiQoQ+nedPMd 6Yooba2lungeeWEBkaNWhgaF2BkYcDJPU0Ykp2DAriaSGz5l1fUIIpTb2qxR20N5DNLE8qtcpFHJ IqgSJSnr/Cakji1cQEIvUvNl/Zi8Uz2gNrc/VjOYZWTl9VWVVKJIzcnlJUGtBx7mmKUw0rXtQudb fT7q3WJOE80bKD9mJ4owhbkQXVmflQUpxp3wKn2KuxV2KuxV2KuxVBTatbRStGyuWU0NAKfrxVZ+ m7X+ST7h/XFXfpu1/kk+4f1xV36btf5JPuH9cVd+m7X+ST7h/XFXfpu1/kk+4f1xV36btf5JPuH9 cVd+m7X+ST7h/XFXfpu1/kk+4f1xV36btf5JPuH9cVd+m7X+ST7h/XFXfpu1/kk+4f1xV36btf5J PuH9cVd+m7X+ST7h/XFXfpu1/kk+4f1xV36btf5JPuH9cVd+m7X+ST7h/XFXfpu1/kk+4f1xVFWt 1Hcxl0BAB4/FStaV7V8cVVsVdirsVdirE7rVNNl1e5s4ruGS7jY+pbrIhkWnWqA8hgEhytsOGYjx EHh762XZJrdirCPO35xeTPJ2ox6bqkk0t88YleC1jEhjRvslyzIoLU2Fa9+4rfi08piw1yyCPNII /wDnJLyDKvKO11N1BoStshFfokyz8nPyY+OHSf8AOSf5fxU9W21OOvTlboK0+cmP5OfkvjxZX5G/ M3yn51W4GizSfWLUBp7WdPTlVWJCsN2VhUfsk070qMqy4ZQ5s4TEuTK8pZuxV2KuxV2KuxV2KuxV 2KuxV2Kp1on+8r/8ZD+oYFTDFXYq7FXYq+WvzGZ08+60ykqwumII2I6Zqs31l7zs4Xp4e5C2Hnfz XYzCSLU7h6CnCZzMlP8AVk5DGOaY6py9nYJijAfDb7mT2X5z60kn+m2FvPHSnGIvC1fHkxlH/C5e NXLqHW5PZ/GR6ZSB86P6nm/m7TrDz1+Yj6lqV1+hNNuLdFklCNdMjxRgAcVCEhiOubPT9qQjCiN3 Uar2dzCVwIkPkft/Wyfy7+VljbWvoaF+aF1YQTSc/qsBe05SMAOXpfWIyWIAFadst/lDHLpEuvn2 Vnx84y+W32Jnqv8AzjpqWtCE6t54v9SEPI25u42n4c6cuHqTtTlxFadaZbHWAcogOIcBPMpZ+RHl 9fL35o+a9EWc3K2Fv6InK8C9JU341an35LVT4scSjEKkQ9/zXuQ7FXYq7FXYq7FXYq7FXYq7FXYq nWif7yv/AMZD+oYFTDFXYq7FXYqxDXNF0e+1CWS9sbe5kBoHmiSRgPmwJwGAPMN2PUZICoykPcSx e+/K7yddRsI7V7WRjX1YZHqPkrl0/wCFyqWmgejnY+2dRE7ni94/BYve/krcrGzWWqJJJX4I5ojG Ke7q0n/EcoOjPQuzx+0Iv1Q+R/Rt97zzUtDvrHzjN5bC/W9VhiWYxWyvJyRkDVX4QTQHfbIz0eSM eKrDnYO2dPkNXwn+lt+xG6fYRWOsQL5htZYLRA00tvKskTSiNC6xA0DL6rKE5DpWuURjR9TmTy8c D4RBPKxRrz+HNmGsR6ZpdrJc+W/NE6WsURmt7RZ6qJI3ii9FoxITymZ3lXagVTs25W6R4R6Zfj8b utxA5DWXELJ3Ne83ddNh7z80fJvljzfY+Y7vzNp0dve3esKY7j6wXjaaRRbvKiAfAGRpSK1pSNyR tmSM2YxAJsBwM+l0QJ2MD3g331z932hklt+aUqpFNqOgXltbXCCS2li/fc1LBKjksIpyIFa9xkRq u8FhPsTpDJEkc72/WmMH5peS5LJ7ua9a1EdOcMsbmXcgDikYk59f2a+OW480Zdfns4WfsvPj/h4v 6u/7UDL+d/5XROUl1xY3HVWt7oH7jFmXHBOQsCx8HXZDwGpbHzTPy5+ZnkTzHfGw0bWIbq84llty JInYAEngJVTnQCp41pgnhnEWQxjMHkyfKmbsVdirsVdirsVdiqdaJ/vK/wDxkP6hgVMMVdirsVdi rHb/AP3sm/1jhVD4q7FXi8f/AK0/L/2zh/1Drmb/AJD4tH+UezsqspVgCpFCDuCDmE3sfv8A8v8A yhfStNNpyLK9atEzxbnvxjZVr9GVSwQPRz8XamogKEtvPf73lPlS01W+/MfzJ5b03UpLCHRjztpG rNyCcoUUglQOKXDgH3O2SyaHhiJRlzcmHbglccmMS8wa7v1Bn1/ZfmIbWN9SjtNZnspfrWny2zi3 njuEFYncGNI5I0O/pildt6Zjyhkrei34tTpeL08WMSFGxYrr1sHzYtda3a2ejxw+ZtCvpnDJBY/X Fb0YmjspEBV348zJcO0jJSgG9Txyoyobg/gOwGPiyfuskPOuZ9V/ZHa0LqGh+Q52urrT7qK3Ea8b S1sJZ2lYv6ro3p3fGSRljRVkoUXf4SWHFomMasH5NkMuYVGYu+ZkBXT+bsN7rmfhuA/l38rJ9H81 xaj5eZIdQsJrmCWa5ikSKIxxMJHdY2npFJ+9WJ+NGKN0YAZlfmMxHDxWPPy+11+TBo/qOOiQD6T3 +WwvlY6WEJ+a3l/zZ5j1vRrnUGl09oFa1t/qKtNyeWV0WSOFmiljab0yFV6Fwu3Q5fh15xbGN35u JLsbHluWPJVd4/TdbXvXJk35R67o/lXy1D5Z1iaS0v4JpmdriJolrJIWod2Kkd+VMGXWwnO+Xvaf 5FzwhYqY/ol6dZatpV+WFjeQXRTdxDIklPnxJpiJA8i4WTBOH1RMfeKReSanYq7FXYqnWif7yv8A 8ZD+oYFTDFXYq7FXYqx2/wD97Jv9Y4VQ+KuxV4vH/wCtPy/9s4f9Q65m/wCQ+LR/lHtGYTe7FXi/ 5a/+T189/wCqf+TqZm5v7qLRD6y9ozCb3mP59anb6Vo3ljVLkM1vYeY7G6mWMAuUhSZ2CgkCtF23 zK0sbJH9EtWY0B72Faz+bv5La1rv6Z1PTtYuJxbpbLBSOOEBHZvU4x3CEuedKsTsBjLs8yFER/S3 4O08mL6JEeXT5clHy15p8seYfzL0PT/J5v8ASrSVLtrlpSodJFt3ZTF8cwoyji/LqMpn2aIRMro+ TnDt3JP0yEZg87H6iGXeY/L/AJus9f8AL9o97b6ok9wosY5IUgUtp9vJLEk/pKjMoijZV+M9T0qT mD+WnzBB4XY4+1NOAQYyiZWNjfPnzP6Fawu/NltYXGo6lpss1reC61GBY0S7t3ur0JWSa3Ei/uxF ULyrxLE0O65WYzjdj9O7keJp8hiITH8I6xPCO41zv9STW8v5e3cLJcwTWt9IvETE8Io5Yl9NXeJK D05ARI4Ql+YYKKUVqfQXOkNTE7EGP69+feOQvaqvvEWPmHXba8T9Havdw2ttKDaQLczenxrVAyfA jg03DJQ+GMM8o7A/pbcvZ+HLRnEcXy+4/rZjYfnJ5jRYxcW9tcoPtsVaORt/FW4D/gcsGrl1cHJ2 DhP0mQ/H46sqsvzi8tzcFure5tXb7bcVkjX6Vbmf+Ay4auPV1uTsHMPpMZff+PiyHS/OnlbVJfSs tRjeXtG/KJj/AKokCE/Rl0c0Zci6/N2fnxi5RNfP7ma6J/vK/wDxkP6hk3DTDFXYq7FXYqx2/wD9 7Jv9Y4VQ+KuxV8u/nH5p1ryx+c13qujTCC+S1gjWRkSQcXhAb4XDDNppsYliouJlkRKw35M/Nb85 /N3mCDQ9O1i1iuZ1dxJcW8CxhY0LtXjE7HYbUH4b45MGKAshY5JSNIPX/wA6/wA4ND1q+0e81a3a 6sJngmaK3t2jLIaVUmMGh9wD4jJQ02OQsBByyBpkf/OOOsX+tefvMWq6hIJb28tBLPIFCAsZl34q AB9GVayIjAAM8JskvorNc5Lx3/nKP/yX+n/9taH/AKhrjM3Q/Wfc0Z/peceST+Y3+E7H/ATQDTVS U+ZfVNkE+uevMP3/ANb+P0/qfo/Z+D/Z8syMvBxHj59Of45tcOKvSk/kHUdK0784jeaLL6Gkx3N/ +jZPqt1e0tmSVYf9HjK3D/uyO9R1bvk8oJx0eezGBAls+hINRbWpo9RthNqmu6asq6Sj6de6ZZRS 3K+mZZjdfa4KTz4yE8K8ULUrrjHh25A+YLk3bMNEsZtP0awsJpfXmtLaKCSYDjzaNAhanbkRXKpG ySzA2X6hpenajD6N/bR3MW9FlUNSu1Vr0PuMhKIPNtxZp4zcSQXzZcN5d065t9N1bWrTT7qzksot WgkS/a5UCFV1Jfgt5ITIsyVtyh4EMxJI4Uul2djkLjE9eR+XP7XLx9vaiB3kJe8fqpmunflBr9zo 9vcmaO1vJWkZ7O4DKUj9V/SJZPU+IxcSy8djUZr8ujAPpO3m7bT+0Ar95Hf+j+o/rQN9+WHnK1Z+ NmtzGgr6sEiEH5KxV/8Ahcx5aaY6Oxx9s6eX8Ve8fgMZubS6tZjDdQvBMv2o5VKMPmGAOUEEc3ZQ nGQuJsPevyA/5Q28/wC2jL/yYhzP0n0/F5Pt/wDvx/UH3l6ZmU6N2KuxV2Ksdv8A/eyb/WOFUPir sVYR55/J/wAnec9Qh1HVVnivYo/RM1rIIy6A1UOGVweNTQ9fwy/FqJQFBrnjEuaQW3/ONvkO1nS4 tbzVIJ4zWOaK5RHU+IZYgRlh1kz3MfACyT/nGf8AL2R2kkudSd3JZ3aeMkk7kkmLH87PyXwIsv8A Iv5aeVvJMVyujRSGa74/WLm4f1JGVKlVqAqgDkeg375TlzSnzZwgI8mVZUzSLzn5L0Tzhop0jWFc 2/qJNHJEwSRJEqAykhh9lmXcdDlmPIYGwxlESFFgP/Qsf5df7/1H/kfH/wBUsyPzs/Jr8CKf+S/y W8leUdW/S2mpcT3yoY4ZbqRZPTDCjFAqoAWBpU9sryamUxRZRxCJtnmY7Y7FXYqwTXfyY8ma55s/ xRfi5bUGkhlkjWUCFzAqInJeJanGMVo2Xx1Mox4RyaziBNs7yhsdiq2SKOVDHKgeNtmRgCD8wcUg kGwmvljT7CxsJIrK2itYmlLtHCixqWKqORCgCtAMiIgcmWTLKZuRMj57pvhYOxV2KuxVSa0tnYs0 Slj1JGKqbW+nLIsTJEJHqUQ0DGnWg74qv+pWn++U+4Yq01pZKpZokVVFSSAAAMVb+pWn++U+4Yqt +raf6hi4R+oByKbcuJNK08MVXfUrT/fKfcMVW/VbDnw9OPn140Ffu+nFWzaWQIBiQE9BQb0xVprW wUorRxq0h4oDQFjQtQeJoCcVait9OmjWSJI5I2FVdKMpB7gjFV/1K0/3yn3DFXfUrT/fKfcMVaWz smFViQipFQB1BocVb+pWn++U+4Yq76laf75T7hiqgn6HkdERoHeRQ8aqVJZTWjKB1B4nFVf6laf7 5T7hiqpHFHGvGNQoJrQbb4quxV2KuxV2KuxVi/m+30VZ11G9upYbu0tZvqyWzcZwGI5SputSoqN9 t8QqgItLjiMMnmqb98OIY3Kh6mPcqxJKsKqx7DwFakqVWC2to7d9RTzBNdWSVimYTK0SmQKvIsz0 HGobr0+zufiQgom2s7W1njM+uzSesPWgjmm48oUgdDTcV+FhIzfzLywUm0FFBpVra3ckeuy3F1JB CRcLLGbgral7haMxCtyRvi5bceuxw0ttT6XbfV0tm80XUbQqsU7LPSQsnOYsxqWVjHX5qK77YKW1 Oex0zSJLua41e5uby5kiEoidfrAMsq8fsFeKleK0O1OnYYlUbC9vJpzrNrMlvdgtNNJNIivCOYJV lVzGoU/D1p2Phiqna6XYWeqLcTa/PcGwYzyWdzLzKBo2iVmVjyX4ZutN9sKoC20jTrOK2jtvMV1M DPG3pQSisnO59NmYIy1UyyMHY17DqNzuxTfSrJdNuUEmuzXW4haK5fnzZiyqKsTRuYIFOtCN6fCC UgJJDPa3N/GIvMV/s7xr8cfpBbdGmErUapjdVIqa8qH6Hoqbj9Gok4j19kSWf6237wHjHwJZV32Q n4yR3w2tLXmidfTXVLo/oOSWS5KlFFwLcRSsjyFlFFWQIeTDvXpXBS2p2nl4X0ZltPMt7NGGcM8M 5YfvET4Tuw2X4l8C1cUr7byPJbpCI9XuwbcRCHccU9FSg4r0AZTRh338cPEimTQRGKCOIu0hjULz c1ZqClWPicilfirsVdirsVdirsVSDzfN5d0vTZ9f1m1NxDaRiF+I5t6c8ipQIWVTVmH0ZGcxEWW/ TaeWaYhHmUr0jWvI+tXUln+i2tdTgjM40+9tPQuWj4hS8akfFyApsa7ZGOUH3huz6CeMCRqUTtYN hS07z55PutC1O7Fhc2unaY8dvPDNb8Oc3KiQRIpasitxHHbjVegyI1AIJ3bMnZeSM4wuJMt9j07z 5K9l5t8rvY3mq3ml3Oj/AKEhjLrqFt9XmEL+pHEIgSeQY80UA9TTvhGYUSbFMJ9nzEoxiYz4uXCb 5c0PpPm/yTe2eqkaZLYvp1tJfXVhdW6wzSW5jbnMkfI8w6Ghau/IV64xzg35MsvZmSBiLjITNWDY vuKIk80eTfR0O8ayb/nZJRHZMIk5c5AIay/Ft8MnHvth8Ybf0mA7PyEzG37vn+xE22s+Ur/zbe+W 0swdUsIY555DEgjKJ6RQK4NSU5ptTantiMgMjHqxno5xwjKfpka+/wDUv0XWfLfmDTdRvbSxaWG0 mntbmF4VLSPGElkCoC3LmeJ9zjDKJCwjPpJYpRjKvUAfmlFv+Y3lC60XVdZOnXi2WnSQreyS24DN MZERVUl/ikjbgTU1G3tkRqAYmXQOTLsnIMkYXHiny3/HwUrjzv5X02zOoXPlnVLK3tSiGaXTzEFD SmRfiZgOPrUPX7RHfE6ihZB+SIdlSlIRjPGT5STHV/OPljT105ptPurnU9SUXNppENv6l9RavzaG o4cCWO568qftYZ5QK7z06sMPZ85mVGIjHnIn0/NSufMPkLTPLC+Y3shDaM5tvQMAjuRLVoXhMb8f iT4wwr0rjLNERs8kY+z8k8vhiuLnfSu+0LrfnXyZYvb2Vzol5d2l36J0+SKzEttcNLGGjEBLBXak lPhFa4JZxE9WzD2XkmCQYCrsE7iu/uREPnDy8dVi0c+X9ShuNVryWWyKK63AQTPJVq8Vqolam1N8 Pjb1RYns2QgZ8UKj/S/HPp3uT8xfJelXjWVrbyppwnSCbWLeJTpqTsigI9wG48lTjXbYYPzEb8u/ oyj2VlMb24qvh/irvpOU866I3m5/KhaRNVWP1V5KBG/wCTijVqW4GvTsckMo4uHq0HRZPB8b+BGe W/MFj5h0W31ewDraXXP0xKAr/u5GjNQC37SHvkoTEhYa9Tp5YZmEuY/tTLJNDsVdirsVdirsVYl+ a+n32o+QNUs7CB7q7l9D04IlLO3G5jY0A8FBOU6iJMCA7HsnJGGojKRob/cUmsrXW9e88aZ5kk0q 40zS9CtJo0S7RUuriaWNkKrGrt8IDgivev0Qoynx1QDkTljw6eWISEpzkOXIAJHo+n3U3lDzLY6v 5c1OS2vNWe+aBYxHc+hcU4Pbgn45YniBZelD3FcqhE8BBB5uZmyAZscoZIWIcPlY7/I2v0/QPNN1 5X1ZLWLUnsrG5srvy/Ya4VF07Wp5zxuFFQjbBF6VHbfJRjKr32IItjk1GGOWN8HFISEzDlvyPv71 aLUpPPnmTVYooRpM1po91pkdpeOEuWurtaNyjXk3pR8TvSvfvQIPiSNbemmJxDSYoknjvJGVjlUf PvKBstK8y3g8q6ZNo13at5OkkutSuJIz6MwgkVkS0cE+s8ip0239t8AEjw7H0/jZtnlxR8WQnE+N sO8X/O7qQegeW/zF0270HzHc2iFpdTll1COOOZr/AIXrBbh7iMj0wgSGq8ehI74McMkaPn9/e26j U6acZ4wf4BXLh9PKuvVkn5aXeqaCmp6XfaDqfO61G6vIrpLceh6ZjXiC7Mp5N6VBt3GT05MQQQXC 7ThDLwzjOG0Yir35/tY9Z6R5hl/LLzZpB0W/ivrq/S9to5ISvqRyzwfCgqSWQREttsO+VxhLw5Ct 7cyebENVinxx4RGjv3A/rZL+YHlqXTvI1/oukW+qavcarJEVZne79IwypIeRY8kUqppQHfLc0Khw izbg9n6kT1EckzCAhf8ARuwVTVZdc0/zdpHnGHRbu802fShYXlnDFzv7dvUMqkw8huWZVNGNByr2 rKZInxVsR8WOGOOeGWAzjGQnxAk+k7Vz/HRLPN2ledfOmpaVHHpEdjDDa3k5/SJkWLjdMbeNJDDz pOsSrJx/ZJ3yGSM5kbVsft/Y36PLg00ZXLiJlEenntv1/hvbzWtonmh9I8j2N1Zzy3Wg6ykF5Ksb emLe2mCxyqaCsXpBaORvTImEvRtyKRnxCeaQIrJjse8jce++jI9Xv74fmXpUiaPqEtpaQyWkt9HC Gg5XZiZXD8vsR0PM9qdDlxJ8TkeVOFixx/Ky9cQSbq9/Tf2noxS303zZpflC6/LxdFlur25laKHV 442/R4t7hlYyyTHfmhLDjx2oOvenhlweHXx6OwlkwzzDU8YEQPp/isdK7kRrfkXXb7zdrc2npLBc WltYTaJqUlVjNzaqikcqcWJTmpBFKnfJSxyMpEc9qYYNdjhhgJbgmQkPI/gMv/KjT77TvIGl2d/A 9rdxev6kEqlXXlcyMKg+KkHLdPEiABdd2tkjPUSlE2NvuDLcudc7FXYq7FXYq7FUFdLqp1C3Nsyi zEcguFYA1cvHwPZtl59DiqFt5PNRCm4jtBWRKqgevpGSj7l/tCPfuK4dkbtwXXmJ5ZhLaRJGlwyR EGpe3Vj8e7CjMtAvvWtBTAl0cvmc2rNJDbC59UBUHLj6RjFW+1uwlJ2qPhHjiFQk1vrwu2vLfTrB b0rxF261lKmYAKzAhhxg6/EQX6bDcVvbPxJcPDZ4e5RS4/MMAM9rYMeILRguorzUEA8zT4OW5rvk mDccn5gBiWisyWMhIavBf3SLEqcW5f3odn5E/Cduwx2Rui45/OH1BTJbWhvzPGpVSwjFuUUyNuxJ YPyA38Mdkoq0fXGkVbtIkXihZ4h8PIxnmpBZjtJSlO3fFG6Ea484NbiSK2tVkZWcRSFqrygqiEhq clnqHPTjSm/QJRkkutrbRFYYpLgx8pVHwoJAKlalqgHoDv74hSlsE/n0OBcW9gV4nl6Zk+1UUoWb wO449uu9Qqh7eT8wodPuZ50tp73lzit9uAWkhKpxKH7Xpj4m6V74VRaXHnN5Sr21tHCzPSQE81T0 zwNCzDkZKe1MOyN1eKTzNGpaSKKZjChCAhf359TkK1FE+xvuevXAqEt5PPYLNNHaMWac8N+Kr6aL bhaNX+9DNJUn4TtvQYEpnpEutPHINWhijm5n0mg+x6dFoDVmblWvtiqYYq7FXYq7FXYq7FVO5uYr aIyylhGPtMqs1ABWp4g0Hviq71I/5h1p1HXb+uKu9WKnLmtPGop4Yq71Yt/jXaldx3NBiqm95ap6 nKVR6Sh5PZTWh/4XFV0txBEoZ3ABIUd6ljQDb3xVd6kdK8hTxqKeGKu9WImgcE1p174q09xCgqzg Asq9e7GgH34quDodww8OuKqYurdnVFkVmcFlANagU7j/AFhiq4zwh1QuOTkhR4kDl+rfFXetD2dT tXYjocVa+s2/qen6i8+POlR9nx/A4qvLoBUsAB13xVvFXYq7FXYq7FXYq7FXYq06I6FHUMjAhlIq CD1BGKqH6PsNv9HjooYKOC0AYBW2p3VQPliq5LOzRGRII1RwFdQigMFFACAN6DbFXJZ2iRtGkEax uKOgRQCNzQim/U4q57KzkILwIxUcQSo6UIp8qMdsVWx6dp8dfTtYk5ULcUUVoajoPHfFXNp9g1OV vGaLwHwL9mtePTpU9MVc2m6c32rWE7AbxqdgAAOngBiq4WVmImiEEYic8nj4LxLeJFKE7Yq19Qse IX6tFxHGg4LT4BRe3YdMVd+j7ASCQW0XqDcPwWuwp1pirS6bpyqVW1hCsOJURqARQinT3xV36O0/ ly+rRcq1rwWtT36Yq5NO09GZktYlZt2KxqCSCDvQeIGKuOnaeZfVNtEZSeRkKLyr1rWla4qiAABQ bAdsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVd irsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdi rsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirTcuJ4 05U2r0rirCZrj85hYWxitNBN+Ina7BkuvSab1f3ax9GVREPiLVqx7DFVt+Pzpghii099BvZhb1mu riK6gQ3JlagEaSyH01i413rWp9sVTbXpfzCTVof0DDpkukj6ubj6606zmssguQhjqopF6ZjJU78q 9sVS6G6/OFoGEun6EkxUtGwuboqGEq0Rl9Ku8XL4g32qbU2xVWW5/NdlUtY6LEfUg5AXFzJ+64/v xT046Ny+xuRTrXFVG0v/AM4JJ7f6zpGiQ25P+lAXlwzqBIwPp0go3JOJFaU7+AVaS5/OJ4IeVloU U/on1/311Ihm9YAcfhQqno9viPLvQbqsj8uN5jbRrc+Y1tV1kmT6yth6n1cD1G9Lj6hZq+lx5b/a rTbFX//Z xmp.did:b376f855-cb6c-47a3-9f91-c32e58c5ff1f uuid:0dc27606-3bab-c74f-b992-56edfc22e9f0 uuid:f2567f4b-6853-4181-a6c7-e4a2f6a23376 proof:pdf 1 2 xmp.iid:bab5062d-7bbf-4e85-b051-083356223621 xmp.did:bab5062d-7bbf-4e85-b051-083356223621 uuid:f2567f4b-6853-4181-a6c7-e4a2f6a23376 default saved xmp.iid:bab5062d-7bbf-4e85-b051-083356223621 2021-06-29T16:33:03+01:00 Adobe Illustrator 25.1 (Macintosh) / saved xmp.iid:b376f855-cb6c-47a3-9f91-c32e58c5ff1f 2021-06-29T16:37:37+01:00 Adobe Illustrator 25.1 (Macintosh) / application/pdf Unauthorised-Items-poster Little, Laura Adobe PDF library 15.00 False D:20200611094511 AQA PDF/X-1:2001 PDF/X-1a:2001 1 True True 210.015669 297.010661 Millimeters ArialNarrow Arial Narrow Regular Open Type Version 2.38.1x False Arial Narrow.ttf Tahoma Tahoma Regular Open Type Version 5.01.2x False Tahoma.ttf Tahoma-Bold Tahoma Bold Open Type Version 5.01.1x False Tahoma Bold.ttf Gotham-Light Gotham Light Type 1 001.000 False GothaLig; HTF Gotham™ Cyan Magenta Yellow Black Default Swatch Group 0 Adobe Illustrator PDF/X-1:2001 endstream endobj 3 0 obj <> endobj 6 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/XObject<>>>/TrimBox[0.0 0.0 595.32 841.92]/Type/Page>> endobj 7 0 obj <>stream HVM5uU("XRLPkw!=m{30 !ges+Wț͂ǃgↈ䰪3Hv֏_`2ډ`⌲9K#g endstream endobj 14 0 obj <>stream Adobed                  }!1a"2Aq #$%CDr&'()*3456789:BEFGHIJQRSTUVWXYZbcdefghijstuvwxyz y !1"A 2Qaqr #$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijstuvwxyz?Jv'JaSBB0)!L! aSBB0)!L! aSBB6bBJv'JaSBB0)!L! aSBB0)!L! aSBB6bBJv'JaSBB0)!L! aSBB0)!L! aSBB6bBJv'JaSBB0)!L! aSBB0)!L! aSBB6bBJv'JaSBB0)!L! aSBB0)!L! aSBB6bBJv'JaSBB0)!L! aSBB0)!L! aSBB6bBJv'JaD3{ÅfF,R . iilה*tjKxNRsN%9;)&+k#E{[ cV8n[Э:C96by]mv;cלx,K'&!2FcEƋɳ|h%G sV aٛ*C0٭ZWY`_)̧iL.b.۬2Ȭ嫶Q$D${RRC<[n:B[FYgpsfgdt8Ѓ% F4GbPM.0o#}lSuWƝ>{t@) YP #8 $`peas$fc?7Xng+]iIsLRaKa"ЖR5&T޹9fT! Z $5)v)v"ysbId1NqN{ۖ:pՁ_LْXmKN+\gxb-Nֶ ;xp+xǞn* GWqrGK; tN@wi.#=fd.jά]1`;TAuHvJ֧+jZqgF3p]FAY#Z8 (cq!Gya)xq"Rk)K')5U1t"!yg*T9iVԻF̙|,BӔPvGf5 dJdDFV;K{vlKF4B ő!khA\u2ҙz12YQɓ\0*K0TePnm}:N!KxS/] R*^JT%I-V.1vl\дb: `_9A~-~QLlM+w3k1p5IH6ݿ6ct:4uИ[R؏`sZepl"bb#]E O4)*nHDjG67QāZ$[+Fn'C%1AXMק9i܍`.qjk?7qQZ//.7V#[|:LA~-Z6"sŚ,tP aѴ-R|c1uvͲi)KH/:Y%6gqݽxX/RISe-G/Ս`DR 5 voZf;Gbր旸ԹԺWfVՉҏTOB)iY֜'P5-|"q@c*X5 k=벭TXnWt)!r͘пJv'Ja^aT5md袝+חRZ &`Wkph.fVԣ&N3ITFS ,y6JZ061mIqZI$e$꯯aCaڹp0#JPxJ@hd Jp;`ܙy0](!mb;o+$73;}1_!(9ė92I%Ěo&<Y++c$ʠfːKcAwT _!Y+oj4<$ڳ2\sqλSƳKɰj^z[ 6ZXqmZ3 B|h1cHR^i-$Y>y<#ظ)t R2J4 94h߀, jх%*+#Z*IԫuYxn{L\0'-.l231* @ѪI RHdա-˝S.JﺁdDUjU` 9nfVf쒔ٙ'Dn5 @m+<,a:SJ*Eyr$Ҫ 95' Vz$6l"uYY{7HZi8v"Xn&I&^* ٣8[6)ҐLA@+SR+}Hɱc`=f<43S/5'^A9`Cv_ &0d%6[T,٩  rYfY3-[0bNaqA#,hg9p5n3 _ZÎ0sekLrWR* ̠N@nb,i+'09uj]JPSԓK7 ; mT]փJfbxzg0.s$IqE4YrI.8py]eū*a\f,4/Jv'JaZ2!}upǷ_ {7ZkQCUg2YSwA0RD*: QPtE娨)NRI:YW4y8;p` xx굦zvjӞ|x$GRn ;kkjYxOçs ux)*E $nz7pVTv҇Q05Ssp FcE1:JՀ ա4BMvMU4TZܾh9ZqF(9cG@_D`;]iٖ-5P)f FD.QV*Jv'JaZ2!}upǷ__f# X[+CKdkp-5{t=SȸPۀ(V\5 l6X@07qk"%)S1 kg7wI4$% 2\4ZֺJMԍHj^]|ZP7e0-U@]FBuvVjo ʻ :G~0R90v I ;Pu0ue{gBX(v 31e,tl,j6 !o (>\銖L SKJ~(r2ѭ^ 4{!JRg[7hCrmg2"Yۘ׈/x#!va}@}b9vE,YPe75.q׆ޅ^SBN%TKI+7Oݗk {Yd[j߳X!'nͰҁ;*ȰȌpױpCK*HYș j2W&.6i| a2@:@\:N,\Uo1K[*٫ Jv'JaY!wWk(^XfSj}uMkpºVĊH3!¡ c +&gP4üsgesش*:Wt(9i|њ|&;K @.T |f kZkB Sqċ+Z-ϛ?3=:Š0CeCBBA@â8p7]v%  ij,x$CWTX |x/9%sIMI7xB.aI+RR@B` 993]7)02I{PSTTֵ.Msٸb7Wzll99Ԧ3|ij%1cOZqt6i d4ٽ#93팴IyM8*ʨ*yeE hEi@0ߖQ6re7,rJӅ l`lJS13u21%p{]X 9qđv@?pV l٦Nap5lY=$sDHR%1X(/{C\7sbA1v`%0hT4Z_D$5ojG /EVr ̇2i<u LjWĥ MWQ]JM&L[S:# AZhtl=N 2U,R31 l4 Lixmi jm!3ʅBҕ IꨲF{o=^l0e$]j؎!8 B֤,pe3s N=ԖiW lXt]0F+12sK Jikhma,ً Jv'Ja^uj-D"nRwCxO5V,ΰ:6 ,BEro+[V 2P96Gf0|,: ._%  :R{%gmmԮ=T\h Jx!`S"E*-F޳pZ7K EĻnkPo$ 6BN50`rn;v~٥ Cͩr21d!ݽcjr[ !JeAZe(u$'KV')֖6iƉ8ԧ' Z rnڵ&'Mbƈ4{h.;Ԏ|͌wLaX |7` RSW{#ir)-Hx:t5Fvkk3Zsͪt ;cHhuMq\A֣.Cr`x(ysaaۣYFA*bÉA@溎0"00_gVutTΥQ0+HH$Jo#=()9+J6`&mx+x+ y4؀a'JMhR+V&$f]vVS0Lf-š$ uI!ȵx4^"F,tslJck)A#\ߖ0Zݍ9(׿g{N@/--UbHӲfM_UYԳ™ZX?'+.ClG sJ<&aܺui-Һ*J]BEz쨜uz&RX!ҦbuN+;QH$1A00NacIb5T.'"RWGJB.Q Ղh*Fuz0bYYƈv')-s4Av,,0EyeCKI7I̋4;MŰۖ "2H!fåzW&`;醯)7+ a\f,4/Jv'K5֖"S49 1Ey6STTRHm΍4["u4Ӣ`p+pc\zH R+DA- krJd̫ηpf&ڐfg,jԾpr s\DB`q0BLXLzJZ`|;ʓ-VT?ȭB=lޝ,uVMSJ{3+.cEgۨ\C~]k;=<<~ -d$ FmZhrp-sqޡkQhJ ,ִ .BteX\Q ԣ0y؅Eؙt[U=HǒQ4hcP* 4#T/,Da  \xhvNQ*hMLO%=5A4JivkSnYSÍ eF5n0C #^*Ep3U<4˝Z*)  BB@x/u+ hx3@.ڄjDm;vW ɻ2=6Hl`y.xq|Yh$HV.MOsZ]"" h>*7CܠȻ_J^||h+ҍN߼-½ebVNd̅k|wďh%v.+C|1qF.4DՀ/ eR)jeE[GR' FsJ+p!r͘пJv'KQ˩X lJqgF)ҩr-KS\sfyxLЈъPZ)JJRdSv@(FNvzњ1/̈5%k\ Ҝ)A\U%znf&Zb@ uc?s<ρ3t+MrohBf$e)AvO g❸Wd5\5[ŝZӚVBd@ s!M4d(c]^ ]q4«]e6J+JFis"ANMDec\֗QsnkZZTW$JD[! c< 6&%ӹ|It.4~z.ac,yCLFn`-CrdŒZ.1B:ܾ3[p~b[NVك.F'Et MGKĆȆy8ֹ9rDe 6TJa hR)R Su" 4$ 99 io8 +q]F_+ʐ JӁ*̄"Dc Hlpiֹ\@$h |qL-K-LVzq#Tt>Jt]?| vQEVJsվ5L2@3M犜V4$:ٯXQolM -\ƭYk>дe&#Ef[,0CK HPVҵKa 6gDmLC介D$$#DEĮr Zk@+ [ + b/qLb(۲)Z־#v@vkG QcCisbD{a Ǎ#c |N1D4x:8͜;0H[Gb)N94^"҇5a5atBֿJ euEP$q!b48۲K;lK30ε' |X`NԊbHб'P1`9~A㷉PRVA8 SG|8P`;]PUk̔GadF5 дB9A.qUJv'JaSBB0)!L! aSBB[2IӯFPjtV!6rVhgV'7S>\bXN vzM5W+wff%30eE3o}92Mٕ &[q gC)Vod[E͗Q-4Nj5YsF]q ة垳Ch c)^)!@(@ ;-+>%JUSp_NfD9nۖ` "v4R_夂Z] %+Ju6TP29+C!Š6n!~ukA{q"6sS+( oCN`<]JSVwm.&+1e3k< 8yx "c3")d"CYmg+M`'i rBb!ݡJn *3PehLL2,=#(;0vkb1!uFZb[=rF;a"C{kC(+q -ˠ.ØwӗiP Jd vv4wƌ'fNqL8i~WjNZS&$X/{5s\MI&W< _Jv'JaSBB0)!L! aSBBINJ^n׋G4Ro]| mc_<O`60L&Y8IZT PCC3Ѭ(vNضP;aĉ Ʈu1[WCԨv 3G j1Fh)z<38J4͒bbK9ZCD=.chx]p0BaBg#"S`MeļC-ŭ[ʰ&ֺWմlؖS]0t<}&\Lm.5+rG[YŚ28geDaQJZCAE@Io p_mHSV@>큌c)ik/୙h^ǷexٸSOYfmJ85 rŽ& A|C\P|cy([ )K΅-zlzYK>w\)Rnh?S4y9A1a9hpq^u } 4P݄E|wͬ3egUeS;KuU^5}}`mdYb3  R^q҄P)+rf aEjhiq;]1K4칛f߰-9$>N +%F,H΀>!Ӵ4447;3%A%<Z %Ρ!Ӥ% TnRRяhL<[S@/e6 r\" #-VbК ōCCAs\Sp /hoEzJv'JaSBB0)!L! aSBB|]^O4&.􅀤*)NX Dnu6w!bH!N:'ToZ􄋠ֺc""s!o;IJG3^I@a1ɾeZJޭF#p40cu8,-)::4b\bpߐԪM|rqhF}`U lՎ endstream endobj 15 0 obj <>stream Adobed                       qz      W!1 "57AQtv28Saq#36WuRUbr$4BVhs&CDX %'()*9:EFGHIJTYZcdefgijwxyz   C!1AQaq"234r5BRs#SbtTCDc$d %&'()*6789:EFGHIJUVWXYZefghijuvwxyz?ER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ПER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""џER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ҟER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ӟER"""""""""Dj-oI4OR5&ۋmrϣPI9nI"',~ⴟ+Y)R:TI|=iX9v*و;Gt=#>Ew.[m Q$@0bAT]t5X|z9ŬWM?Z>Kۮf&Ck%S"ԘfӺh.bV32YE3xa]^s8]Nm9`F3\W˟\RBIIչ b|%Τ$bi2Zc4,Jˆңt&Gp.ٺ;8i fa6flv[HOC{ ٰ;)H6m]4?Dlw=Zy^S?Aw筜8{}~#+o ӞR8+e[ҳ˛:r,ʯr-Ib*QH0FBm^*ien X\*T{㮲HRm''o>tٲۜq0#i'F_ ˠ4xA[ K<]Hs9<"s/M V;^=dc<-%6FDJJdFC-}[SFph;AFEd6s-L͆99h#~s$OEZl,4괵0ZAb! LT'~צZ=sSe}J3r JeNŎK!F4HG 56F {TZ)G=ưH MU:95̀]vtmcxwU77ke~ҷo+|)Knkie=&A([Q@f[ ˀJ&*if|dDIL#S(4؋L%@n( {U8H72ənb4.\u)ΧQ7\ӘZAN{Y»tmqPjεܴ`R+ZxOSpaVR[$Rj< Z,*<7[Y c1=&\pfL"3ShY hu&$ ƄaYs69Im:mIɠH;9ȐT^}]t5X|z9ŬwM?Z>Jq6ujޮhjM *Hn|)uqKZLC>Ok~ݬB%NmkrZhqTLCj9Rv V_v&-uh2KiըLL5` Fԋ'Im 7{nآ"\Jmς5( Mm*M.{5Ru3$HukfN $ISfT{ his`v :o'UBʥ-[\\IYeVFi2=+v`lyGNn78[ADw3c_-B:Ǹ߷7qJAm4tY$dq#ױ%O=l7qc,[xvϩ[*ޕ0p\؁ӖyefU{ihZH#VFZO"F7ShUUN .pPwuŸT"F\guȲEh9<\y3͕Ů㉇ 6 I=2I]vtmcx>V/W35Ssz֟i[}?Qk`5z$ҫ>ԃKTWjI$Kݓ"3p{dhZ;YG_5|֑cnFuqe9xw&r{Z;3oRnԚg.c?"b7[TRNY4n3C3#VJIu85^x`ӅC#x"sFjw^ʹ- 3 Ĉ-'xCM[$H \&$mjv6^.)4 J㹊%RDs2Ni2{Y5c<3Īp>y !JԢ3 3iP5F'  Qm\4Ss- Ei'M~?gg}_gk5Sszֻ+vϧR}]t5X->TޣVoO+; m{7 ~Rt&~T$ǎR*\ŚQxo7MjT8" 62(`ˮ}kpNٝIܺ#w%;e\Z\Aw}M2@h۴\wTY6uɚmdVeRp/7e%f5ƪDFn3~ PTXV,K@nZђ{ڝf,_Ei'M~?gc|z9ū7٪~}n߾VO봏{k|z9ŧ٪~Jݿ|˽Rqy.[oݒe2E& MKeII[#5Dylgĭ7l;%JuBX@.dx@g Ԥ;.Up繭谺E !anfMҦuWH "-1FD#Rmf,;lT"y =+I"^#JԘw֘僗bM)wKi3W{eJPڕDp$=AuGI_ݿk+ǫZ~TޣJݿ|Ei'M~?geb~s?OU77i~[)lv6:9jRe˵d? jVYJ̋NOz}"Qݭ n3upӸf{]{NV݅2tnbsZt^,ȷ֚SYmi6”#\il+m##RLRTJ>zu^oh􃑂WP8d" 2xݵU]BK^ȍdFarޛT˖Un$ݕ%.B6 :?ˁ5;=bC[K- ;,)vqVcXj*1mBz{Ys)0&3.7۪_ڹq%a¡d@6QhmHZ[ՇJK!E ydYVkK s"@$L0,bU`77nG=;we>+jaǰό26U8%2TW<}2#bL|Ԅŗ d"3Q3à$N!MGH[R@8DT3~JVaٸڳ~pjl6z, 53ܣLAz}R)]Jv->qM)uK$f4gȵ7ӤTw̉ $CXmhCeq H`/ [M7.dH&%vړJgߕ5ȭRYNTj lcB -)ՙ$Ȳj2IyU4͒.$c0 0u.0HBM69"VI ZoUd3sh @3 ]UYsSbҭ5DT=ɚ\F2S2#.ްw3{scg,#DO~sX{6d@zwjDhsj'C{i=Rͱ)LJ_dY :3>Эd: Y=*A `5 bW =XtV$S"*CHiM6ӓ2ǀd\)vgHhHCj"vnq<ҳTcsڄҳ}_F^eh35gF'uGI_k+ǫZǾTޣJݿ|+dMm3T"Ӯkʦ\dIFRY4KAdGj3IgMhK10ЃA! myN&>sk'` N]‹EW|Û]1p"rY[MԍI\!RCD[RH2 4߸'vLTJҥjL;kLr˱_iw%:m78zF|5wlgHmJi"8:g2[_ T'G⛧Ud\Ji3p=Npi}\7V1t;]}"JTxZ1HeyaR!"SD"ɧ#뼱`',87Uh-pQzpjMJ\6T:n)[i5k#3$g;yd٩sKȗ4ÖjzZjQhʏhkg;q˺TsKaHK]t5XV/W3M?Z~[)>?N~fnoQ+vϧRͩZPhv.5)GoEN*r%{&t|9 a3 7Q/%p8Nn|TiHiv@̵Ԁۧ~guGtn:gsakw׭g;-PKmR\TgҖ3r%\3]ukuag18繭nsIѠHk Ghm&2W^x3d&ѤNT%jwU\nX+ztCEzKvJ[J(&ۯm//tC{GzKvAtA4X2,tF-bT}C9i(=R]"L%Vb%k&ߡ%ɶMeI~#!wA$j$μ}*iQtTakijT.s۞s]WMUIb6i'%є&Jda"2I!<`o&oeg&sfn"sι m]DA;㸥,%J9?%}5UTʫmq(Ԕf\2D&IFCwAlkXy_@QSԟER"""""""""孶}ZbUvlJ^B7;?©Z!&)JK&f|mrc2Y rSg]jvШ5IeGs)Mp GYi5D6`7 ^páv ! wg!-tNDznjZjI)[2z;,ƜJ炈juZ$N` G!YnU !8npȎmijқUzPC #.P=uz6#>YmV+|O]w85>BѵY`/r>GNCҧGi*zi =1[ê_ST5~Ӧl]%-lI5A+J6dӅ8g֐ $|212pAS8Ei4s\ባ4t.e-t$f@xD"7-)ʵ} Uu,{UfܵVw! <%P76׺$҂JdfIBUp:CD~+d)1VS}Z8 h'19I;" `鶝Z`;kA΍ =_S?cR ZyPni!(:knxfFFk4Í8A/SN4i<YfiS8 P )TMP@:Tdz< Z֢šǛ*b6ݫJ ډ/$hԝ$JI.g pj#N"IdA6pڔg\55%lxhqj2<Ƀ#9g;éOMuTK+U\TS넖#VbJNS",Mû[lfGHe7wg1b*Bjͬ4%+Isv7wc*P1Zi o!٘,5g\cԞ~K}`7?RFzN3 cpX-[A5fcm3}ƪ(\ɧ12#5sy]}#]clB]"Y47v dtHX8?Z}x03 f%r\]\t*UG5j5Q)#8EXuea8<гm4#zU-xa[۶ fhP-I{Ʒi4!߼͂PEJnjx:@`f`Zp5x)o!|9ֵnsk^!;@pF\3u[Ob?rÏ|گo+}3֐+OA5CZ:aY vϴX4L-Do{FH8_g.AJmi bG##' /VN,?9HLKY,JقFm`$~NR#rқlWڟPQQ]ǵZfmUgqRRY #ym{RM($FFd+0/uY s1 I'A12Ce7ը)S ֈs .иwiժf. Lѐ33>U &VddfA8<`t8{y8ȩNV˯ek0|mq u2uKJ&Lʠl}[-j,Zy-Smڼq-W2JyVI2JIDq"^p' 6218Htxa$ZfDng NKzPH]A9Vph =a̘0r9y:{@TZiuN5UE8θIb5i-$p%8M*"};j4wp fX3{gpsLF"t-BZi:gcqoXWv> xe+ p"vꎍnKһ:(X-uqکt7u߅8:44'W4KN5&/USgۈ۪RdOknpa6!`8lx߹].m4x8 !Ѩ;|]/뷅VDZ^Z&* lݘoStڸhRJ1reddJJHdd KzOZop C3D"t!Wgkj0/.un[De'~YW1v% dN$ԦTkj؂j8RlTSבC 2d. 4G\s1MSûӦlt|1V c!>:ZUtJU6etj$BϧA䥓Noj[,)F\steyְUɀ{9"Ս3)YV4ݘ$i]s_eva--vDD88lo6;-};'L-m);7H'~KI{;hl_iv"kaU'Gz5ߖ:t >,F*rs&OQ;w07խNY [ކS Cѫ*}N=u֪e6+N]MlMK Ȍ/(jbkƭ/6`̬H5`9s=á#g›m{1:pqDBm鶮[=j3S͝)iNrpRX%p2f:K78Zn':;6r,*tI,]:LjNZE؞ lCFMh_Wtvro$˾]i|je;Mnޣ|anKlQ=Xn-oUkTYEXΩIFbܣj~1S}hjk;{>駱. <;^|E"Gunr_^*|?6wZ%o98p'~Z(U4kӨ61ܭ~@|'N^wU7Yr͎kg'e.7V#{{SY.j^uw&YFĞ ;~E[z`~{_/5v*]W?sOژ{{dnjHlwf(2N/ջw>Nϒ7w|.::ַ5]JILuFDHb+jud\UŭF#kFq0֎RHֳP5cW:-2E\%*βܺ7>,߬H6 r 9(m;"$ l ftpjeemO|j1; C[aܘܘ4!Bs=ܧ, ]V:0w5քzkO!J4GQフTJM+Zy)"xiwg&DF#R [ Z` rGT@Zhu' 8ȖhA3 L_KZ6}RӚ鴲Sժ/e&yR{\'ťˮiw@x||1\i밀`+mg9aGX= {ޔ*Vpݭs9iq2UvOMM!N.ڹjNr^) >gr^+3-4xZVȑ cZdAil25 fKfexr A\ْN;ȸZ.uONbUUHcLgDGД- ,HutSsmc8_8<2dRqU緑pլո2˶* `rwۄ/ՃisL3Ū}-DVWN~_W1@ZPRɴ(ȌS,c`=lbLSv[F'luO\[攷yg)JR{j6 Ȇ7»쥔ou>WFmwI0>=wD@jXcZJ鏺PSgK9~8ډmyIRO$djlkvlJg5ih KZ|/O ױձkfj;o¶ㅞnWOg'O4滰x H.߯G֝O!4FUܷZ_&T)Sǩ{EhI[Η\V@SI"qVir׼d|{||0vZMaq2K7rtY[i1"7`c<3m Z,Z\חw$Th۴]]"nݵ+bloĥ_b}cX۪S5lw{,˻ir;z3 pʅ!- Sf4239 5x19+z #pܹYzt ss"!ń׼Ұp~=5, fA@TWQkԗ.%gHͿGMZe^Y$iq(tڐ&2Ԩ\reGcf&X2K;ƞrж=NuG}T;L9huvweCOC"AxݜJ\ 6Qxۤ ׄ5n u 9L!AYgL-#^00"Z NZI@Ipt9{( /n.0-r"jb%668 ج\b)$EֳM۷Lo;䕺L NRfG#GꂥgI!rldITFF`H] h՟ER"""""""""孶}ZbUvlJ^B7;?ªUl}vټ6õu?wa[q{m?7.lմ_4Jn՞R3s$k'[,%(՝o>lU@;:0$0;- 2^\Tjo k'i.;B{p셗LԢhӠ&NWؽSnP%l-FdENHRNK$DSt6ou CgnNI0d^ *r;F;;[Hdm]L?l:z7Q|'o}U-Sr ymVt1cc%|iS˒|?8tu tUJ1R#}WZw|?VG*]Շ.+7y x5ʐ5cr#Ɣ鱃 (󃭕թ-ϺͳfƎ`:zNU$ڥ]wl疲.ܛxBx#B':<'4t.< J9XΆEխ|Uk6[8:OJk*]tmn}wTu8dy,:gO$2綞*`F9ӨW]0%`~cǜ*6eGt^㶂Ƥɑk6UvMxw432n`TO)Co#^6QhpCO3+mOfu}h 1%]6#",iX7C^-J5 kqXi*B-q=u;Jǩ<#Z\n*uE?g2.[޺i=84P =wC-M!DuczT{n!m)K9t}(ˈp7ua!0K'i2 Tku Uw״sZexRQvj5 kN߄`hAn W!A]c* sOjO hTӶWxz4@ jZC|?VG*Շ.+7y x5ʐ5cr#b.Ɣ鱃 (w󃭕թ-ϺͳfƎ`:zNU$ڥ]wl疲.ܛxBx#B':<'4t.< J9XΆEխ|Uk6[8:OJk*]tmn}wTu8dy,:gO$2綞*`F9ӨW]0%`~cǜ*6eGt^㶂Ƥɑk6UvMxw432n`TO)Co#^6QhpCO3+mOfu}h 1%\_P9_z2k\2oCtky+ mJ/? YiU sL!ˮ)ީviںmmv4OԠTݖjQ)XaVUBKMK-u@D,7)aܦXm3d.9˜\t#iˑue܊}wuGSsM#yfW%F^_Tj}iBebg;0M[Ry33333ˆu4L9.2KO0h.v1@ 4N'RI: 5. =g4l0%L&\@sG SͲ6wKO52jaqOO"4XS܉)]FN+Ktl-mJfe;0 I0@$\x>꘩ã[9$@$YW=HkA8iqbcLYZ^hR=9c-OPVnK俲[?[0>:EG_ZT/+-c!8]9JV٣zM䕿wQV~KU[Gg|Jkv;p=mB_t#gʏQuyk~JEc]w§tr͗@"*uO=֗GJ7CS񊝌VGV[Y܃ޡ=t{_uk@U]k=a*K7e%8Q)"?gBN@\3'#z)8xܜH' 1x-bb='sgGv2@~.߽~}OSVށ+ں.wmiU~Kz.NR`j\) g yEV8d +b}aIs+!#V :e>NGHغWOF`džGtSJ:ueK-mR?6_+3gV*4^JF׮[b3MTO?LiȓJb䶶l"J5㵾UͣPUE7Ay iˤf+dA  ir5oj~~КEoOrh9\zhn%yI+-ĥ*V X3";nJՋ!ZaŹĽ3aNYEp᤻0kv7z/3&\t'(ЯԿ~ԫ ^ҧU侔ep#tE?uFj0gBchwHXqk;GJwk+?}\_Ɛ}/һ? n~>T_#Vqz Z]c|ɷPd^6ݔ;ͩlEFW%!W$iMZAA 'ai! xQuLtH6a6uj_;wٓ޷b/~?M\~Vށ,C]s}oݬ5]6_ݕPiST;۬R .9H>ൊW/Y8{Ս'.龶+93#vݕ-<[8;"A" bôn;|OQ|ɿ+|.Y%7>{GԴƊ<7]<Z9eEfwL}ql BvQ=$-^Z vf.hUHDnjv{7BٌMtJʔa+pⴧМ3GUeqq;2OY[XUQU[pifQ*LRJdG> !۽ɭ?sQ_>}&6:J4(5YɅ=5][+N]cL0~LێMk[6~-T"Atx8i 좭Ygcpפ5ݮ7}7Fb@;`ӨH]X>A4S1=?TZ+7-KԬ~_W1Fv.e\>t۷2{ /lĚsͯQ#"2C8l\۲pSpNi %jv.~29 \#h#"6}׭,*U2E:hw ߦ5m(R֓JgSJAl{ {I|YzYhnD{rsu9Nm%!\/{@sI tikdeD98\5iv W4ifNط%C_Yj^iF&)y35$gې>\cjOX\59; .CT Zqgl]x$5Bo TM1d9jNs*c/ö;Ս[|Sv,or{? y:}65݅vŷo`ZDw~|ޟoj>~ 5XxEZ彗?6zn-hٱQ{ؒBE"fdUͧwF D)^|Wf'xb6lWu b2t2`7lhV ӀWeY֋E,OtI*a& ض7;o[~?MJ)[zԠ}o]bVvhujUzvHG̡A܊8NN h͞&>8ZwB,uzL7} Dbsuf|NƁYoSkmJxyܵÇ]g :&sq'Rvh{Ov)C}7U*9ă6lˆ`U$gJ$2׳e6#ojLclCt-k]#v]xAJa2b"X @e:E{i~5`]U;BDͥr;o} 62'RFcFCv:vuZӰ<%62JMjbiHLx&@ 1LO0͜shk [nf1rޗ4h9b&E5" " " " " " " " " " " " " " " " " " " " " " " " " " " "/֟ER"""""""""孶}ZbUvlJ^B7;?ªUl}vټc|ں滰g}vЪ^!pi2e؉oy&|έ8d&IQ|xF52]ZI,9᳤f' ӱv-1* -01"VpZ}le' D SuӻdWVGȃQnKChV"}:0=t#LXEi*$܊ }*-pyu1_.U]kʅfc) $%OHqNdDjQ.Xe4kִLZFg%zΪQK$$*} m6kZ i/샤lse*d?6xVgƧLuЦ-HU~{ib9VP׭ _au1M%i]hJЏ; JuJ;{T~3 Ki њܫ-VJUæFh0ߩ-zC5ftn8Yr/4ќԺGjeWF[hTvbkH\Z{6ukfCMqI9ɑ-Xk?8J,O-cA;$c#~6ڂ?>1Ry.7buK@1NԠCM=BR޹ZI$feΤѫ+' s}`0c>P3!ZYF9Q/icGIp (؎GaG"/ GcX>Bҕ\kz]NROֿWʩ|=`]~QOLKj&u7MR6  #}HNlߎl/0\qi<ZKI0>*l[MpmCaH E꡺dY=$+NxTk?H'H0WDGc`V0V>'ٰ6X<^rTDҀ·v9%FZ5uO-nKΧ9r4p6ê1z\\F-ܵ 7,mF15S. #a,[;bZ&ʋ)zm_kGWguhY[gl[鞴ZUb;uBWr3zLSnIZyZ,#mRjҦ lV3Z)R@XN߄+dOόThG9 ؝RuP S;%:D({ePkF2Tz:Is-4jJaůw/<Ϡ.T, iC󆖖Q-yhoKX\V2QGb٩6G݆H4?qWhTx> \-Vk5*/=.rR׺ʳ-ԙ<%$_^pdԣF5``aՍ'2u*qY^:N:dQF=g֣N5a{iۚ[~l'ADhRFvdY,Tj":ZZTypX.8!ke-0 5k՞Ak &uh=\! 1H#qdϻ-YO>IpN Ѫi8$ud cc]4:=+ImuyHO?AAB.K-UŽ:K#I1'4_;{hX,>UOB߻aV2*TumO͚7nI[}g.G5U}}w˿ԦoQN%N6|7WV5[*}G,t "gTit}zQ5?j>~G5e=)SؾSw@_/}Hjͧe:D2\|Id)zVRXŒ^fԳ 5&r;9wTiP(u0=bVM=]8x^>?aU;Ae?b_IP}oZZzI^ϺqʻtZcUumsIlRy$N UKLFkAlg̾2v;V?~{a[ŇccOς5]19X-mR?6_+3gV*4^JF׮[L]FsiH0d, jR%woJ}Vgv tMV4FV[\t?S}}'ZѾ~jj?'huiMحzvǦIZ97Ν%IGrn߉EG(4kAc>@l*d/ܻ o hڪcoF m9kv/4nyy=O9u~M]ïz$f-.͔5IzmRgK}d<k5j6{}]4ڲXTM@6gf(<z1Jete!EuÕQ-zsryhj\fĖOxSnHk? lY@^:q ȸ;RloĖru1jлmjScA[c*X*}hZhy"֍rТQTޒm(Z62{,iFilk*:RKo"y[5Zv\$t:޸UJ&,%Vȏtl$ϣ&s8|F2~imNEbT&o'5tH.-,TX8 xq/oZ{M gŪ}-^DVXgq?/V=I<6O,"rλ{O}U&}TkY-zi?xiJ4.5=rqTF{8>)<ι :j)^,]t 12\\k n;G j-C:54iv_vڝ}M z7sR%Pm&qm*#%$;ajhmQ!c#枱 V8P;#z;}BoM'6 _ţl}v滰\,or{? y:}65݅vŷo`ZDw~|ޟoj>~ 5XxEZ彗?6zL;>Ӯԇ8׳<ĥPGӻ𙎿 PAZi˜&\vBg' @M#k:{=\,oLq'Rv[\a￙O]?Z>7Q-tV薘M6ҫgZ Fzr"ٳ8m)Rt.PK.LŚK78Zn':;6rgSI`cRw>+^h;ahhɠ س ͵/~j޶ ܪ *Ra)Ve*,OSna-stsIkD 2$4*k[1AȎBY-,Z.-stsItԑˆDɺi{tȍ=#NI`G,92-MmX$`ykF3@u&EI 1 "$l ݞ@Xڠ Dy;hQ=MzѫvzCEKJ;[3m}RGhډYpHd$_tk%iT ,n!&F rCLhF6d0ewd1Aa'@6T{!kmiq%%I<q##!MqFXA]VjA:+nlkmV٧JoɭKU>t; re.}Lk د< 2j@8 !Bh`9s-5NGgĹ\9Ln!Ե{L7gȲk5 N0pOP]3O\1TCƘiv2cPn暦F1Ѣ8jY!&Q.9"DIIvg83JXÉ \`> dē%+ڰ0!3ԓ`w'B r.<` l$]K]οԷ#VW8fqJXRM:T% Y9S"#B=x@5X~R$ ZI'avg-1-umUGMs;w6''=xXv2d:,kt7=@x蕝@DZX{wRxF-UK:(X*e]`[e4dTIUB##FGYx^Ә591plŘy~Bm^1qZ_Sc5Y6ʦKnV뭴nZ*ii)BI$8 n^Tֶ@ZNYI;e\m6uIq$"I2NDF\藳Y ab3et6}Ԙ젛eFh.0^""l$OoU豂_L481uE?g3ழ[ޭCC|g rǾUymW y7HxYHT=jvf%ȳ/Zjm!J*ue(KdOyDx" D|V/浆@-.}-^y$԰!"}d- ՠ5CXh"s.1xZʔ~U =i43'0I.A\EV7̚m *Sn-J/uF:#6QU%JJ"i^T pծF񰍣q0)sf HH bF`@Y xJ`{ ,|LLbi$ bAhYr[|L{KÔ<1KWKpa˦|&_l qg4^J Nd:1iΡi-/M5 idhs=#.->Vk>㛩2.Dfpc4%8 @LI2\\Mͫ Z29I9I06 ypOt.JM,`"&RI=ԻٞuKr=esmI$S%I2[Qе2"=( Y͕"@լԒvhrSٷX\4x4<1asbrx]S݇pm&Crf|wCs Ծ7OTtk_W_SFzt5 sKˬ)j?ޔXaatS73;R1sw]hp⌸hnv[Kfc{1B ۸߻-5-T{㉘4LN9ګoAnœؽ>џrR5|bێBɈ)=d< ۈ7 488eHŊ h̙)Lng @97ZyyR44a)$m+tGn-w[OMouymS r帬RHA&J:TDyzSRuC3ƎRr̜+Fy4oq:INwN9R4yh]l lZ⾩5&Rn߆$%EyS2IJ38cketUm&">.$kfj"sߜӢGL1@ݱU_5͞hpitrvںg=6J /3\U>kViRѺ|`v#5)-%HN39aՒYLƸp[C[#KW>X\D Ͻ;oh'f}X_w.VTm4f$b<)2Fudfy˅EKjDq.$6ʭ:f^#-]+2Ѹ~m#ڭ}8ixs\<..# LXgMڥaҫM&F!O ѺHGDpb^c $F79ksev;Ŗ91;_%K-baK{ :;v^ڟ4oAɼ.**7 u?٪3c]5=(\gݖSX~vs` ?V<:p;eXVƞaJg|V?q6D`]dyW kbEhOvl1}GI;RN9!b?+߬wߪ38VbӇQqCm|ZIb5o Gb^ ZLFTnO=֗GJ7(Tb}hj˷{{>RkvJ%pe)߮j1,xW~)c88DbnY_9Xf#Ү\97+_cx? 9fW}?q;}Zدg?u3crܛ?uN}uҏaŻ0%vKϹ7"VyYoq|w<71kR{ |w<,g˾Y hak;JU.@D\ϹK\lJ|͟X#[^^gz~U)^nº6^ջ+|O\EGh]CWV+EYw0ʧ޾BW]Gʫ|}e{7F>oꕀZ>V.5ܾثPTUu\ϖ??Sjc9iVYu ձk3/A;hVQw:W><:NWSU&N;djO дiQF]J# K R=vy۫U*îs\rlTԅSiYdKR6g$RLK#=*Uc:>+ݚq5ыwxS?[{mSrºwՔTqTny;~sNVofH컒 LD&_S%8EFf9[GF5tUwiQbn7]Am[C/:14  کYP8%29`d ݚzӖҽ7fݏ0DrD(px$L9\u)#QKs&D[œ44;ڜ*c["KK`9N Lc ə}K\NYdI<.'j53o<>q1.t;Rṧ=P%o>Qd Np%$I.Cۺ,D5=y'2NdNeX-Z* rVF cBrRdyʱ7SOfzƋVnRO7 BM2 I3O6u8-ĨI27 mS4/9pѐ1t 6,˟nAdT/o܏ܩr?nM :}4ibCOKȝԽJ$'~@#u4}7ǩ:;gi5%SPzYv{i0ϣ.$idp4aԒqiZjLTik"`9dU aTld ;gV6*IZiI㬔ٖLIQl6+"7q HH&cSưC*Ih|6LVѐښI d##b[Gm Ռ[|Svxg}k9y+,-k{%K{QFwh|/Q/.}w-ɳ A[&(ݚsZڇ\ v;Y/sLn;n}+q!gwWeܸoŬGxƇJ)-m}{b,k5> 3wW_s9?Fzn]ڟ} װӟ]y?Tnͼj|pbX @;ze=3ປb#n=9W]p`_Mg3AuQ5v퉭[6m;l;Abɦk[V۬-Y33ii%{ppny6^<BLs@ ˩[K$ӳֻKV8FAw ݊hTp4Ͱ̱7Gk gVN$ÎZ%M.uu6T-jOvXx"r3:l Q  wQI]|ׁ#b:cM뫪tiP$Vb"Sn$餍;7FffgejQf'92C0rȁLC4TkIsL`6FFSU1]eF`iys85$ƐsPF.2CRY(0Q!В5)DD;' $I$ '`a* m.v@.o V*.]`O' de[f*^hn鴅!U+z):*DA'V8t gM/mKC|@l%hc <)@qp 2Z;zۍRDqN.䕼> """""""""""""""""""""""""""ПER"""""""""՚ۦZQ|^Ҙ;\۞smI-*:ui7xtNɈqU!߄Ƿ̞rpic 7Zʟ-\b;^_Ռ81TpwkXnan=Avݓݖjs)Lbil&'IjZoiɡ)FpX@At5OM]NnɓD 4)e iĥi<.#*ϢդpiGT%ITC 1-"Fj}yTe1Xa2#"6B5 ;Gd??`wZƾ*Jo`#v%s˜r87c9CdNÈ0aQf5:)mܬ,9ԮԴF210&'Xfh4KR:LJ qgS粉2amӄ&^!e$A #0s ǖ *20AB}bIط-ZMoG|ЪOhi#(%_i$[I_+<c6;0Z*ӁO}l`fqmvˮYs;v-@7vM- 4gDm;=Ӯc[ߒ6gemcRvaV-A8:ȝU` %AE0 "rEԺ9ԔmZޱ_O DwE T{Q$>]}ԙ`Q`jNs`T{pٙgѱg#`(˅񎁹'h NAA 㩴t47"4n D)li&AS"ѨxăIb]}ԙ`Q`jNs`T{pٙgѱg#`(˅񎁹'h NAA 㩴t47"4n D)li&AS"ѨxăIb=<~U~ˇ&A\Mg'巽Qvnon=Eq98&-ޒlDDIO:A*EFz9258IFId|_֛10dr aٻ.tF'Ate@2LRݦZ^LNc?ɵlλfUwκr&/#s;ьqU*m8q'ËOiDFٜjgD\NpBp7a-FӃ9q`Դv>~gGϾڟ?kVOʻK>gG}?]֟` >oT썳/X݇ٷg}x=[m_'nj#ɹ7t2xo 8Mb:0qtF,SJrLoLò"']A›쵵81qb,k5σ:.xڗu^V0im[Ж\/hy1'|.Ex<1,cb0L^vOugIGƎp3W;1q*}ɳS+X,Wn짰__c\ǜs"uN9}恵8 䭷t?vٟg7z7jUjuu|o蝓91C oc=*s^>Ӵ.-vAn*%~gG97Wv}([vyXisy(ksy{ۙO3[nc{1s38DbN+b ".5dcD!:T[=u7ng9V|D/Z]hÏ< w0GJkg@^N ^؎\{rہ2U83Cc38]+Ko969G]I51_R7=N!^==Ax6xɉLqcz\w^G!e<)Z'^Ŷ|KP\̟Ov'f݂uou%L~G琱s8䯜ڽӇܟO,>>fu5^||9iв%pq7,.ݹp̓ԔON+3SoԞG뛛7U3Ot61lbOX|}'RLby~_!ef>1Q;cȎYBukF\-gL"t(܎ rL7&^$Ɯ"3-dH̄Aŏbn d0ASi9l*sVfv APAG>`|&\SѝSkm, (vtj(617잍$T+"ݰvUաn}7<]u&'Ϡc9/~ڍ9a>wĈv|uGI{]:-xB̸߰U_101h :W(zهYc̏zsT8뼽ٛgx5ǣ^؎-Y٢rֻ)[UYTv}m6n)qs a!Ԥ $냗O--{& p6]IH W.D9p7n+AkZf t0r$m\H=uL(_ٕv#ȸuX3Oq|oV6`^=fg>2+.+☳ڱݷu8y̐~##kS;솷*۰ՠ?."ճ峢-Ԓ"MsA{9)!kv JV֏o9DF!ЧtD^qQc!oo:U_-K[ԗbw*5Orم-@D[RYP:pZNApimAʔJY-ZTi-&xH;UFѕV5G|9Ln9,L̉b&D2E`8-`E.vb#l;`2%avїclFk>"$.:P~7LmFs*JQ'~EDfp8Cd r &t^o/*K1L@#Q2%>a0S a1(A NgP<f+_鞮|*QE?:9pP5@D@D]zOvm r]sKf"ZwGĈey>.#nRPy [Wp}tɀVa;OF)]1J h0TLkh5 V4PDm/dj:5p̒ռ*cgyRf/85ÆCBv<>MtFo> D|բY-uh6bWN=p_UP9eJV_K4L4J=nK3.%"V1ˊ#Q#XQlFo~hwwJnkh?fɧˋ>ʏ.ȐéqHȌw,iЂ1[x؛kңÚZ{UʹZma0IIv)VҼRX5ZR l3Y]h5$7 7w4MZADC}I<6Ty鱒dM<֢#$s1=,XZ-$d8M;AԨ!)0ܤ_0YX6k4㔎E.m{IX7 79>1l̶ViAӺDHk) ,*"39f#2Gf<s-`1'yN^=ǐ0yۻMX թ'qk)= *JE:}Vc@GvTW(i֣ )3h0yaѤj81& ͨrgUR&(wnTII4"f! h5t}R0b }Qv_V-/{3l%9!]nnwXYK&4.9缒VأU\ǣVܬ*BRUU%$6/h$RI\ܤo|1Xx??y2xyapb_vݎ{DF' .- P# Y $p }5پUCUv <}SFϮ[I՛CDvR"q *i~\e,Ŏ)$V %xLȈkUfiТ%-5ѠI& 4K@*0k$5$3+Enkhm<@I$ WhhzE~Ea%Hyl&|RԓJЬ(ڙT$,pp*dKDGD髷[T%Roޣ|anWlQ=cWV#[*}G,t _U!kO~I_i QAYR~TLnݞlHY`t}o)vʳh5M [?jڵsz&E"^V51q?ׂX}<6^_ҭȴʭ~S52#cY$JedGOZmыL! \5$gaKx3~vqvsEsq[M5BZfI琑Qm@oFʏkujURk:-nR5<եe1 !hC '˜vɑי޵V[hR gsb&$$i\Z6 kHq˫[L% qFIRFx"R,ʴ1Ta&Hh9H TwQN`T{? ,5N'8U⺗ECJlZ]ZeW"OcǓ'E)MTo%$' Vl0ձը4$: @]t٦CpV40Z$$i5H+qY~T mq֙"'#UFZ՟ER"""""""""N 'I R R/ho,;23Ū- (ﴺ]W AvhVeBn j]ϫS)mͷLiQp| ~Vis֘%-!<`Vn}75c2313~lUgv4:ّ-*g6κmWzCfL%nRl=O['#w23##=gnfqi-\ss#nr%K>@\CG0$Zwyr`t{8q`8wBr&@踭rKT*}C6AGnTwP %6TTe64AA ƛGAG&fTR\4sIk1Vѽ}jtJEWԚj7Em!DBQo$D|x_5ck>glo$ҰӧU՘ / C1g7^m[I3Hq'd$Ӫy>QXkw(Tb}hje;{>RpcJ5Fb ѩ2™-$FdNDBLGpxk2d>ƽ@Xz8a.$ ip.}.;<81vA,T 2"ZE6`t]~pm5 AN4ЯgLwGM.rQwg}o|<$L> ׍[(>03ܾ<o`f扉sHsG1""Vrq37 )\FM[3{m?7+:2cC(ͷZq$- ,)*IƤ1!iOTͱ,*Pl:l3j b 9UYNɠRCn(%[ǓVGyw/խaxK+9ႝ#x"@~RkM7 rN`Nյ}-֛EMLrrigԡiA9mL5e=2#Aɀ#BwtRg=b&B>+{HVn,ZcH߄0z\VIv%gDuo)vVm5˸ﭟTmZuzcOۥz#V,=r~K72%$e!h{iЈ=*[ME[@吂j=-ȤI$De22H̸3!7Al-ݔ*:q`LD{'jǸIN-owNJ."y"}F2pKDK^W4CC{vYjJL>o`uu m` >i;4(~irAaֵۺ̀нXǏşK Q6>ͶQX}nSm'_pIR0YO>rausvQxk"pۄӢDFqL3"Nj9FB9zT{XEg^]W6)nKN} h\)QP2"X3:EEJlv\='uxH)@~ 3Юr^&b P{aoͿ ەކm%Ld3Wc*AT3ƛYڦpvm8)0somH-t$A\&zZB^&: KWCEqmZra0,8g\GrT_S04WNLa]=ݎ@i9#KڪZc ,\Ej@"YfĥLR 3;8ɐGaʸ)]jK+KQ mP(ʔ&E.nkDZ8 DK)bQI5SϑO 2I'H>#,)2H/k^ӡ枢UIsdh`>wV̪cPZUW"]+ljFZL,$\*2 k .bT ʼnXk&(*֑4raNyJ;uRi͘;rCWmU{.oV!]<;\'֏fC*{>6z޹ϕ=ܲʴ=§سٰ͗[bC)ʹꍶmܲUຫ7‹uɡ,@t^`'ذmUgQ"[LJdM%ӂQ(fy333mԵT5k82Ir K9ٙNvBY\^\I$I2I'Rv\ֵyg[e Ae@ :HY( 82$8 1#M66ERkgxEŎ9(As~$6qiFS6Σ3LKV⥻RԾFbS6r[Zw}ȓ&xҴwΦC^$An GsKF#wbNP +8Mh`.LsPu~5=)ضǸP5&Ϳ!3"锤4NJ"3< tK[EME׃?c߼u]!kV_6Ufļ(* G'PjQ&VW]A,$FG$;kYi$4YĀ@-"w6(W( p$ؘ[ ܆dmMYs &Ku'=ӵ1jL{{;J>oQS1v"?Yڻ*ͣF]7/(=[ϳӽɃ<)1&DSY}CnqZJд*aT###,on;[U\55jE7Aq0+dA CD+Hbwj߼~)?m~W{oZ~/տy+5j:krVZ5h+nlTkԄŰwZ5%iVHҤ2AԧP AtTmJ #8'I|FJ"Qd g5.$:V6#-6F{:{Peh7K) )E:-T}GRY%)-8]q+"oM #=->a`a2 F]igsAl: a4%9F).Zכ+>*8/!!F$ TQ; *Vf zﴕOԦ#JZO􎫯g}#KN2TM7B.FHU\ZZb+BjRj£'o!\dK,E;Y>\M7&e'] b)۬l Ø,{^$ #U({'ZtHdA# dwEҫ$st$ 0A8g<,kl{D 1& w IFbr!N)'֏fC*{Y^}'MB:U(,ɊG*CsxDkffZiepf\!qu2ki10 Cn)")&u|٭M mi{ÇH$.(=L{ժHlVMA֦S%K-$-䚒|uXV ȆoxYiVGRkmZ}|3x0 8g7(+TMnc(0s NTo]Ljtm5Я׵tZBS+r965*=uʞ ^ If326bS 5\{}KCPxOp  !n-r4n [O`='Zs#7TzLXP~($ DD{ZhիP˟j' %^+llbl)ԝY{>RtQN>wN6|WV#[*}T*RǼ0; `p%t zcSdHSSiQ))Si#7xn-rlona1>D8:ZyZf{4c$i)LigAyqnom*DCq@4)nX&sBFȨɔ̒Vt{5 Cjq> /iJkڅf &63hGy W NCc"~sr~:{2G4qx*hNIt5MrkY}mIE2<--ZV#3w`K,և Zsaim]x mDc]GAY`]UNǧ$L­jruz[W#NFp- *AœZl"ru 5cI`Vpof̞ ;pO*Tr}k*7[xﵛΫVChZ&ߦ.^RnUTѪT5mQIfdWRM^I<)$x22? "W_դ*4ق<"ee׵p%"fkDɛ؏k3iQǢPcDFGں- OGD1p 9q_*ǫ+o԰/#cs6z|7wK3]P*qkQRYRxJH̒Y,بN@1@OI;ʅkJI<u &[=:m*m IȘL+# 4Y*qjNʵNѩLijuIj(IGp߅M T'abh & v51 nִ3DjVp-<`Ӭ1 1'5I۳ܗi, ?YڥY.Sk竡{m?nꌍ[|?T~J,Zwzv P5ϿJ {Sty'62Xn'}νTm@g(1u+Jycwޒj;lqKόճfÆ/ҽ=IBkjnU&V8oOe\1-Q.=թw FcƎ FFU3֭}ۮ4--ocS=uZxJ-AkuӽS.CJ$^, deȚt@ȖzN|WլZ-/-CLGxr4貶S&N^ {%w6ݻ>GݗACHطkN0I:)+w=χwo/u^XjSѧ]ʔvQp&6'~'f@]]܋ʚ` 4sطoRwU"ЫM6ࢄ$[ Ƨ8Fx<g w[beM79 3eJi6SqX:waM ^Nb'=J%ˆMtܷ\Ԛf\YgJ2vk}dj.]X2)Sc;CPK-[0縀u@.MYnc[ZZb?VlŤV:4TVfM+nM]Jj#3ίR4k2> RzT Qڏsǂƴ( e[Np"u t $zZVl)%J$Jp5SJJ"ve27nU&eY;݄&WVӣɨw c9dC vwq[RG7!2A&+WF}KZ[>$%R6-cx^{: W9ybu.:s9A9ZoiuNpٜ?.y4j+l8fqkJjbP"#>]%/Z;Zd1Ql6wn K_>>>QXuw(TbpZ?#['X|ہjy>TzX*s a6]1=2Ҥ3Tvo$ӖJ DeR,hFtTBpTDG ض۹@ HH(5kT弆aQ(|YFhF~"=45;2v]?{G<V[*VlV3y>QXuw(TbpZ?#\QgrfB,kNi/KbߦKk=ԭEiJLdv5J1UsX sDF勰;030"Lt{YqcɈDĉ ?LH=RBub_rTVefIkƽl TkϭU[pk4+ajRYK4%`̌%Q{^Z `ÁK;\DƱ*bZ]g{*`=sRԜNŪ0aѽѝQUwV]Cݷ( ݻ=z>ˬߌR]f#_j.Skf'F6j4rC>ͭWq[pHZfJJd-U/# kS5#QӠ9D efI~ijWNpXK~J4I,l+RlIѴFlMVeQbN9";Be.%+Bdd }Jv>b uGAdA]d7S8AvDAV('+ZqxܗR}.LvfW&ET9m%N-GddpY'wy]R4[f EG'D8K[wO2.o|"7sk=ZhmpeFk#5J!i4-d`ˤi,a-%Ar VIj^TMnɺa )iVQ$\ )Wphpalm=eR}0$f4;Alk8 M:3LĝQ㻨As.}0(wq5cĞhm{tJ%i Ea,d FdfA:u}0 |&~#w`IVwChۺXd[#Y"př@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D_ןER""""""""".vâ]av}Czdj}]ކL5p_.[4 ^`$k\[y Hk,xIh{X`As^`fGxf$2"v6u7ԳÈ4KĀCFgLH"Hh]䤡 B0KBmʉ% $deEuJn.t"#B5UCg0APsEY͚>˚ŝ4y'ʱʺ,xLӗ7%3pݱ$<< IlIsA'SfdA:!eK!uy1UC;<ͦ 6bΧ(ЩM1pm 7y,K%`< k'U9{ӫd@9Xo,idي'h 'i8'j7 % 0#Y:~1o1J~olNlkHbth&1{oN.= w]8*O սwµOTit}z gr!N,Ֆ]܃ޡ=z=$? TxunJtyX*%=< MSvi>\uӶ-BD\(Q$֒xg8;-&Xi{Zh ݇#2 wx-kd ~s+0Ip Ks3YUXR8F7Ûci` :1vWu2ЬY+rM@NLCj4mV ZLP{^qpZI VkZ1 bD["~+d^|)o2gxu:BKMsA KIFby O*v1^xOYvrzT-|>m Ӽ*=Gz_^{K~JNۨ< J_C* MiS>nKf:ٵ4 fpNP\3 >W ɬv76y%uOOw+;_淾3b'yU1"""",tڕKu;BkB F0XP \Xc0I--JJRDD\dҦI2IIIt@ H:o&O*;s=N&[Wkۢ:r֧UڛʕNKsyKZE5&4L55I' ̒O)U'NYI@p9dg`IcFh h& ̩bI۔-H4~0Kyㄔ&N^Kh>?ٛ6ѝ'?)'尪WۺᾱP/<9^mYO ]G'ּ~Vp7k7W*䵾MMI`ʽSܫbaVo{6RgӪt9L)/iJ)QHce`.4Ȇ8p hxCj}Z3eiac0dj6l.'--'mKTTNTz(tҥ-/Ȗ[ӎ;)@<:1Y-k{0D:@5:)~$9xdt?ZMSS~XXenGC:ddf,릅zww--`Mն<RT4'&i223!2M:i時7e5W:G 7D"W}_7= =q-xjj7$+X왴ݷĹ-t߇7JMMt}*".pmU|"M7Ic"ZHdk5SlN l< x?V:W8ͮi]`'%ԃWa\g/[>'X.~1Jh5/(=[ϰ°+~eǕ땓Ȩ?-+(QXk(Tb}hjf{>Roޣ|anWlQ=cWV#[*}G,t _U!kO~I_i QAYR~TLnݞlHY`t}o)vʳh5M [?jڵsǽJFF߾Y[jzd*?%O @p-J.h6Us^6$JڴuyLJ!a2CIqm iAIJIgȸTۉg{^Ll4H^i7W8:I0X쮴Um&j5tj[\.40ԄLT8΂y)LF(}$fX1s[ES7ZPvfޔ94ö8rў[:^*69"D DH; ѭL2rfK.M䴨LL-M;J툈$"-Ľ̝p͟ q`#EZmv!z`i<=!CTa =:NVlcRP$zlg(z3q*Io$RM06gH>M7iWjpOMBo wK9OEƓ 0%iR " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " "/ПER"""""""""չp= R5.2ȑ]z<4CB:DڌFY?aiJXTpn:tCdԐ'S |Z_a{[i:g iחF"NBVlYp{i]ɀs054޺kӍI1#'bADYo**LУFK'ljt-qDZ1Hߵ`LN&;H$g=<߂7}qZh$ ^`aLi-?5F։-A^ Xz=5 q¸ vJA3\zVn =YiCM*jBu6իz~]2MX#~RTQ̈FHtltl c LʃjuL@2N`rQk.8uW66$5j`hY[`eէU q2LĪY8ZLҥ7)N)9#ZԔFp켪tsN`8Ļ0 dA$. ^nKqU0mkfLHvԞp寎XsG8vƂSu2CS񊝌SOYwrzT.8[_|%PSyջ)+ cz\l_#725(Su;GbcՖw |Ob߽G:[P;zǮ-oUGWMtFJFv6Dy)#>z, C+Iu\HƺFegk!ՁT6YSp5hڵ˹W}w4ǾNIF?C̺z&Tg} ڗ5$]*uH;wNT'Oy$*o"(y>.}xSkLhi8wDK tC|>~>߇Qci`bc~I=KF4ȓ:ݳR5_:a(KRXӜ2壹pmx=ő x6z-pN$$L10ӳ: ۂL즖BdqD0H[K56+ [&yT-1>ɞ \IHuƖBdcZ[UէQ4Ȍiw[jf6A7k] 7ȭ<تYja$8sv%%gDo)vśG^{gAU:Vnz6^ջ+|O\EGh]j-} iv'ŌdDDEKRRe gHĽ"bC+Ao1R8M@k:C^ zUMN'{]$*q+Bփ4 II2%$Ȍ$cnW]Tn-p #"5F*Im?\.C MmͫɴyI53{[ @9 Y8t;Bbyݐ]@G;Dwnl˪8|!1BPmxF>Τ>Kyl-p*Se,ù!?9vQphGH iujV9 L"uY*m5*m1SċH2kcIk4K\bKu٫>3lD̷kmk0^yڤCkwm.&+zڪ^ODDQҿ!LSQg,N2G̃r)q֊T ?wdf5*9a4=/s)Ziw%",Z-ZRdfgS8sv se2k;81HL V(ԭ468y)sPc*i3Ruɰ )Mɼ+P$m"Kmwxd5CdA1!."w2]ojiLd7H gY{UZÇ) f[8O"Ln ?`-9mUZn$"2fffgSv׸$GK6Sk-h$:_oߪ~׺˲ݚQV6uU(3)2,%*3᥾J9{KjH: ꨏ2g!Ǒjm֜IhZ IROFFX21,x 9AdZ]IZH 0Bܨmfg+q쇪{;i&BKE2RTiq$ҞZ/Ʒp;}F4q 8y½png@sgVS]K3opKgwHҠy>QXbw(Tb}hje{>Roޣ|anWlQ=cWV#[*}G,t Mvv6ʝXquzhU>26J4823I t^nKmTs-ZL%u3kÔzD+!֡i(sNi"DFm YDu3B.-M_TLT9UPen𤤷A䏆))W-gwLF&g' "Z`3Xmf=`ON`-8Gfwm!͙sDinC14M7: L}PY7y|Zo&fgf}&c%L8ͮ% v*d2` 4&6nmu۪Z^2I'sA$$v/k}~՚ZMӢ&=.4M/Ǧ!e:C  Tu숃$g21)E{wmvz-8ȼ];T!lX.ͳSۗDj()]b4󎺁q\q)' $riqr06nemp.kAE8uTQՍ{IS8g~G-FBnvU`HvZb`QqTit}z }<;'֏fCC*{>w6zڅ~Fϕ=uyk~JEb=w§tr͗@[=T_O?̠pQŲQԜNŪ0]{;>UC.IGOTKϴG]fbj6CQt ]n=nH4xPQCanm4dIB"JRDDDE!jqKF$II:Vw$ H y+S[H>RE׃~_3W?uO؝Z4EO6URzurk'ȓUs[yJA὞hֱeqnqzJ8k&]Ujfn9ts'!$ْJ2K X UtbN47LXe%Dr;i2JȲi0~kZiZ8#B6Zj62=KjK5L eVp铄Fº ֩jިi5sOզ9F3ǤcwU2CRtk*mi='ұܾ??1i Rm^ֹQ%UQcq-Ď-la-0PGD$WX$醒 2 ]LLLRIhլ/vS1=gz^ XEds. $vʥV*O"H12ݲGwpG^ \\4B:{Bc:2݈B_WhԅeZr\RLpwp 7Q0z2nhA]K*m=k.tLt̓B{Iw^I8.+Q Zsw0*,Lh~&9&#nkݎDK\c3rE-CZ-M#CNTT uBZn*~LgdDgM^UF $u0ϕpLT`$L &O9*cVqt+Tcfp;a,/M:]A>ӻbrMrD*Y&w͢x2#VqIiV{Dējm8 D'u(ʽև{.'%JϢZ3{՝ޚGeІVꄵBT,%πdٛGI {$`*V0 HL $rU[,VeGvH gF䙓l 5li̷4cJ\V5$GUh 5j== ;6Y؃@0D'uF{ZmcLL #]+*IBvZSq u S#8HDgYGI0׹NVH& tI%W_3851ඣɮ}K;KtNiͱbUKhHLTj6aY$֭VqHj=h8U&Yi@0D`O0ܣۯ[Eh1|NY؄+֨t[>qR!WuFvDҽo0V$2Z2 AAA¾ `k:K\ AU?.|_Н~-~IF%?ߚ>{^_k~SipQ@YВ#ЪȲi10I6E'`@e^72ILjHq3&LL3hF!3yV%9k\$AV fɏ6iIC>ͭHm֝mD- L24&Dddy#d߿UI AW:&*Ůj h[Zd_.D\ Ciʉ%&19Ή&&򝝌8 Dm+ݎQ@/sbIq9frY(kM6t>mVZyS9*dv%>n뫈-kRԣ33333ȹѾtʵր@ TQmGbxIU mNVj,3ӧ'ulXR&ޤB*JY5deY$֭'mW{H4::\eb  'q:{APDHK8ժ%4c"%ZP rm::k~DjK5-)J333<:7ժCVZ`4 J {$INU m eP geX4(%D<+AƦS$NQHXB5ZC= @.qqI$$JSrZ`=JjԴ<Ԭ=%qsI'AKFozH컺ӕ*P6[Jř$엕{3pѨI!sDL3\# I;$JcVqt+Tcfp;aKtLɶڶ4ʋIf[ 1A%+ GĈ#Z Þ ,A"@:n6EG1|LLb&&* k[7&EiEWթh͊.ٗдOr1$8hA!Ø#}#M(:e"lfxEck\'# T>=Lٺ+Z$Uzs[ مP٫n&x!PHڧ3=k.i.E hi;#VZ 7tދ\>3i9q=%fv6;0̈-]|ؕRmڼj5!꛲J$\ȸ 6}W~L3 ߞIMg a$lUg8WoptKqGxnt=WJ)BR$cֆ}ћެ~;.4J@T% qfI.F|%^4j=Hk'SWHD`N$󒮶;egBF6g *=@^?J4O$̛`icLeoѠ}Pѩ$|H̲>گKEaQ9pIީM$ =*6ltT}L3"b`O0Y \];wIXb:b7:CR--%QY $fg&&/*`[E`&HkL$$@ F  bs%\Wծ=Z2C*=&FkoH,*v.Y]iS4:}:RpҥoE 4$9;Mij=f8N$"L-d"A$"G1!|_6X UP >%f5~tf.z$ SG%2TȒVl"W8Ժ[էHJxHR['H,BRE=&c [ƓpqusI=|(on$h#d.5R|1#:tzKI&V°C٣M$ChhջNg2)fI-VTdJ'#$kM!]HѸGשREdga%f6 J^|)ہpq͸aFZ"""",  ¿D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D_ҟER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ӟER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ԟER"""""""""Ԛ~šK{jX&: Lg:\.8$n{|W+ј*5b11HUiSNjYQ1|tEwn6v\XxQ'(2w+~lX]XܤCd;U{ RT sP[)RIb*ۉ3I’wr0]C $; n`Ûdr''e"F$g2ӷA 3˩[ܶfy0ta5tffգWu.mlBlDKִĄ }n)Ʒ ҔQۯeъ\醁#`%-JTY :\g=%6Zp#U/nű1`/&gb9)sP7w|D:f=gҙ6b' "c=wڽE1 L TYkUoV// 쏰ʉ738BuF9E|c5Yjpb/pb5q\3T;wjq= xLk(]e,l1X[rFO|_~lP>~"???/GQ_|>ns,$*q>, w+ñ<Ң[{kfvΏc39g(2%;[hoO%rDc̶%Yp"Kq&%-$fDfFd0{֫i0-8hu\f ȉBc'@$՜ ཮ڙ8\ G\pHqS jRtE;r[n'%nYc@Kցe 8٬Q۫$ e:Ffn{FɁڡRZtF&NJT˚GwIJ#ADܴwO{%dDgږ>ձ<}V/2g(h'ٸ6l&mc ̻kE]f$ x!Y :43{C=@Apa7qUb5ioKdI0@֫G[́>*} )ZO/1Ֆ%K=CJ-sLvnP -2 " Aȃ]7R  : "(oyl5l̈́ҩ cܬ2,:ow{Fg7,ֻZsا8YHpn0cGƀ+]juiȆ4 eΗg๣f`s eL p=نǶf1I=[JjUٳryŋ ,թmr0l,)=ܙ牌#k=6fk!.']s Tn+MJJe 5&KKBqTYm0ᅧ2f']dɆˣSr3-7j푥~ve1ȝt엞nMfKӜuK;ذ4y'VJ M{Y>Sˢ®b,oVxoY"4DEREVa92G]u{ϓ:3;|D3> G0Y11ߏɪy-;4?³31\<@37n\dyWSkb}E???/e?!Orc"=F|.Jyѣ%\qxqkgN^3ؾ:;JjQ&vPLΙjg+hq~&վ G)|8/(5a*-BK8įZj8|&F')U71ഒ'6v 6IN*s4N& 8 kەsαӥT9 O-n8џޟۓگs;>8}Z؟g?>џޟ۔lѭ'GWcȞZ\9.c-&%2q+ec8p]zu~gcAtJcmu,qnQrI1:GՋK;#2tMeQ_3oFZ G3\m [Z\Oz3 dpk7K-|~ `V(6tܵ_ѓ_ߵ__ȯhO!ɑTD:zދt&KO *?O>;agi~0ΏB:XM+@sEO|2',]ZER=F:ξJfp!\my…!i".#2/ڮq= F@&L*{P`I&ŰI 1=m^ۮc5,q3An$2z,E`Z.5+Qn(շKOd,2)\V;T!& zQi40֍O`m$5$7"I:6I )m^TQ` TCjwU *EB (y7LʻĴD"Q6FH_pٖ믹GU@ı`ˆJhXE0\7 릧qwgq Myꕤ^6ndeԬDF0 :H[|Ռg ֞v0UjAv\96u ,A}*mmU[vb*Lr$Eq Anq9"I`|!:'R{|&30y#߸KR$8n1TBE3TZvj-6I-9/CkR4XA c6I SRQ՟ER"""""""""䝻=z>su]UGgAU:VnzާE@S~vY&!T*ItVOPb2bsZ;w-z[9 \GĐ1ыpԝ׸=SLji'h gn" 6lZt)u Ϣ4(,"CM$ֵDDfcZ\ش闸5@jUڏZ%k^]dAiHfDPiN\Qdq)ۈv&RtDA`#V_׭ 2ƝI.9@l D=-vV(̰w7'ղ,+(;Ǒ3<+X0cNj8Ӫ]=Q0uE6iҭ\5 ?b3vVcTCaԅFƚF PDpz_f|21%.H9\m5kB!&jn~M窴ś SHNVVi"uKϊ8uLr++y6C_i}]{U*2 rB+BgEQMNf%9E#ϒhlI,%O;˺u66f~DG2ĬEj] ~prq7vLX $" rgu!t-dF镕6m"2tTqixdth R"sH8sExeJs.١;vxp/HQBj::2 Ijc:{[ZYyTog#V($G;~Yxiڙ f`;$eVdi1sCcd llMygehp$Né#pjxj\L.ҿjRbƒH<U,TPijyÌc}ȯYL4NOU6,tޥt ,۳xh'*V\a{tOK7N(*g=6iKJ&f$R*^G51 R,7WJaYY=hqvͧ\׍kmukt$0Dn%3d('X ވBM$4 lh+/{>`uGky8%庞Yqt`$@!JãS)Ԋ{(m$PHBI$DDDI.:dNIVecI'X:֘xmMmsu^i(1O DKv ~x,n̯G Sd:1?tkOx? ܻpG#dL\ }ZAp5g'lh3-V5*d5B|oܘfռㆂ58I֜k+QY[ g$BwZjXZ؈F)S)Z9u=iI+w}*Qo`DIV)vMZiקŇ4?&`7z'02'.-Ω7K6"uNg g~7pwbkzF2\6NB{ _*u -JXMzUIjd9qmĆN4kIIRHˠvvZdvf00DWl[BCAhfsQ8+&UM$ЃbDYfA1|<^ Ksk<њjuSL<˙T40ZZO)ZGxX=l}gLDy*iV[Ob?rÏ|گo+}3֐+O˪&L} ѽFy[L3"&)i$ҟn7|HЄoskܶOuT bxu/-> pV.婴~O7Dd]4nPEJ0x tnvS[GNrT6FQ2Q:DVG# ~ XuOGͻrc;''Vbw rĻp)p2rC,0`,v{"}ew?YڻͣF]W/}l(=Cj[SClu!{#B>b9b|%YC~F3ψVۻ{q3l8IYܮ},1tDĀbdo]_ҾlC`>ڟ?kR*}B٣D?ۺQ?f`=s.[ұ̽Wwꇜgp:W;Ia!1b7v*=ɏoŤGxF| \!ZZ8gd'Mʵo{5%==Vz/ |9[Kc݇?x\'Rb^q3:1LO  xct}tu9-agx`W {}񘩇W=[.Ea^z+UI*m8>b(}&DJ25$wi"UNheG50IImHtNyi*-ֆR45njb9{&p3QOOυU~SnTIq\S/}uiRV$*###,sPD6c`x-pDs-*vNTbk5 >^MG(Vb>zԪS#RSˈؙeUO&5 O 0~]Z$Nd{;_NV\zEc?-m ,Stmsu]UGgAU)r2@ۉjeNQ֦MNVd.Sr]b{60%ă 8c~vZMLØ KA-H4ذtWԺmr]ET*s8>ܸ$8ҥԤ<Gaԭf졧M\a4:'i9V;uERf F"CZ .ƾxI`ݝ E:m!59 uqI 0lDٳIhuLI+]BT&ɳRʺI"#$$#ɒ33Ɏ5kkOY$Ld;6f/yF( I0&_KUL1 n`&39+B>v#:Ƈ-LT6GڷT}?AGn%Nw| eywX) %eS9 Soyt56enddhnS'4#&N~=-l[CXg\L;VYfwͩ@siӂG!ZGiaHд Ce&q[Ob?rÏ|گo+}3֐+O˪&媅FӫH"{TZ6DgAJ4AoHu*/f3w/W:PgU7g㎊7n&5ZCy '} 2G|2hwXQڝ IXQd2}[n&QQ% Yaͳm]~8!>k&8p9gs5CvW\7OhAH84 FRaS,r pHVum}$i=.i#lUT0Z|@i%miEp6!wQe{zASUj͔n|ȬuA}ui5#Ĉ&BZwN}WwHx`ѕV{|nRpxԒy6p5lVIҕxq޷U‰\ba-$ycV66SJjc40`G"Dy_|^km-G(1:/JAtӌoiFYC lqMKWxezNT;cNHy mT+ O` qt59*\%\GZjGz!{ba[Hѭ94ӎLQxHr<.n-G3|ޏ-Tȸ4hѭ ZAˎnwqlc@--U]Z縹y&Nt Ť6%gDo)vݛG^{gAU:VnzUwhzG³4tHQ0u:6k4F$pDYm}ά:R^8ÙI'}}i4cCD4#r>K]t5XV/W3'M?Z}n߾VSɣOPMbjY$~lfq,Y %-G1Ԝ!bֳS$jq yhL evnQgM2qIܵUmuĿ2;4OU@/443Ph^:Hի:~dSʲnMJށ RSpŒ8}poKŇlN7l궍g2sNpXu^QkIM}BD=:8r-ToD.= tH*3zKD]CJ[d܇TsɸBRٖd̋؅ iS\ lRC.k4bFG):dQ2$4DH:y>+)=sL0$ iAE@UMnӞkt:($>]'I$ea5j4V^w+ +kI=LfN@m$q=di鮞}SlrJDiCaui#Y]mZWl{[:ybWqgȜN#X/{] FmvZ*{IUnڂegCԒf4!ě-1)So6y"J=ܾZ>k:'k4\8KDhu6ʍi{chQsq{LNNY6.m}z-Wn.WB5بFqß fLwRFDFդfBWlF  ~cCHp5 ĀF}06 p 113AIՁ".+tz&K-\B7+Li|+Q'=*3l_EhTsr98 04239讔"FGBӸJ۰y^Β!)3t#h Y[7Nۯu$K &fM8`Ԕ`7wp LjkDN@rt9 I=R۠vY $CuƒtlȮeןER"""""""""䝻=z>su]UGgAUcő߾ K7d7㦖jYcun[BSn\Lb)} el88Q%g4g}i⽎px葟"dU-pp$RlVYbXN#,c:?9RP=IrRYOiVK$XY`>f~%-V&ԧ2?Wl3]NaaP?sl뫗*IS0"S*;Ce4)(4GQ^ah`Is\d$8L A- gs84{CLȓZZgX]akp޹a0D^MU.#Z\ɄLS &RM;ƥV7Da FAaareMAi{'< 6wKZ6I [{pUE")A4fL '@JeUjr}]cHKԝ-Ǥ)#N̘ Ɛx4xt+Yj:֨@3)L 44N f@4 ;Q8'`D@u0]Šm*]L5l&$̕m!ƪmCn[@)-NS+dTfӺI#χ"| ]ts˰9!ci`ۿ%>{THp\d CgЫ_kuB0As]Xѵh=$j5ּJ|%rǪ6ֵ&O!e-leq؉WX!ѭM4$D7R5yu' NU1^@t  sL+iGP6#\q^v}U^Moz{ib9u@XTնwi}>W:"ե({4֙ JTDE)n y2i]ͨ S\i龛XH9LƊJUF+#t.[K_EM烈\m79 v׍-7T:(+ \15 Yf-,n 8EN*Ņdp8"5%ӠWKic03q7i\䅐w<ͪ峾is 4:&6<DNMa(uPj,[R&&U#iOQ x88yxe-l'< 4a7!B:dg 'ppw" ~YnKvwP+VOfA!=OBIm?B Tc$p0kARSMgW1sUAAU:NjzZ**,Hѯ7|pChx9y:bix)1 1bItE_m!m@9`:'lJ.^Z)41&OR;V$97\JV'\"4ņ$T=",dwOӳsHɣI<]rmN.5O8 .yUu{sNvqSb:uf$KϴˬߌRR?k Ep [?jڵsՂ kצz&FudU fI#Q&g WI {% |1^.=:&^ƸDuzU?2#[7~ڕʏ!}mZ{>u^_{*ij{eZv%Ru&%TqLm(-JY"Ex>hiuW .1$Φ썳0']s$zU}=Uj/443-^)5ޔXʻiPu5l54nlYx?Hȯ~n qGzLDƻԬj.f@i93j_\3HX ZyV e2lmB3܋*;4:kIIRL`]hmV5AD)^< In Y Rk 9=J[[g&rC͠m庚^ۼhfEJI-.%f#{Zmܬ\4$T鲥r+fL|2v tku]&~%ԃA #I9x2rhh~sP:qf֩Mv\:bhR?I?J ix< .Dʰj*XAF # \PsQ<3AWK]{3\:AA"9`(Ԟq%iÝ Ȏ-6R\P222eEuRsS1!<79DkŒ<'a26]twml(L'y2`طh̸/]>V&ǰ(Bϩ┥Ҹjܴ'58su]UGgAU1z'K֬oWTgUS :e˨-mlz5=mnɣ3jKJC8lӍ<$N)eREyՑ… XTDŞbNh=dHU\/F580e)G@>r88AºXqC;⅘ٮtjq&CKs" B.U-n8~kF2k@DU{j~lѽGsw&Jߌ訫? u?٪3c]5zu͸/wGa%Wע߻aS:9fˠP}o7jyxO3  sKˬ)ת_:GZq%~ML~EFl 4߹!'-V[u0ark[vt-Q$rTsl9t^]Z}ڕj<ypsa(Ս.7ȏ9kќ=p.!ﳾ{@үă7ٳpϾ׼菔EKUHȔ̶ǡCT Ai%bͮgh6Ȑ$np ii6DSP:_V67پBV~Ji-_0]Hڧ KhU:u}o3רuZRI۳ܗi, ?YڥY.SkYUݝJנͳ5ٔJL(u!M)6 fH1yw:ׯR]NK0\Hz]w,zt i F?i[~}OG]vnu+mxBY[~=/T;}iG)w=oE:Ro^-0Ī#8kDy"5fXpc8>zucB 35H^,b&c\ ~PNP+h}0KI-rN qdwGsOziyվʏkl;{CH)G,Su=hTpyM_V]7ݫ**WiJbӒ%_4͞]m8$՛J GHẳ;_sUu7OI.><94\.I N9C99mI׎_Xc]?HYo1*:?B?rie*.ङ(u ;0A9`i e4?XЉA!wW 89JW)ͮ-pєe #Ul]u#M(i>z5N%r)ȹhq#,̋y\u.Aƭt@sNo1`$r{`9oiy4jև٫s iEn~VY襩s 7RU s%%dMdi.$)6v=u٪ 9xFnnRydÄUYm9t adЦII:"I%]K] i,$4I1. NI+,Ϊ>8uM[Fթ2edFKDKI$ vH,5r8~<ιNk ෗"=h:X==I学ׁQ ~y3MV R͚Ӌ۱% HJb2)@#)R{,oQHƚ6NWw)KasLw}Ort(Mosލ^+0kAM&2!Ҳ.sl |@'aBћ]RGu.Ga_UџER"""""""""ѻJi{X;Pؗ v&$7:D,i̺Y, IVm4;JuXNq}Jm:}70tKW l[iZjZǂC`9$P^$>ʹׁUԻXK*GfXjooYy޽.E%\Sj W *r4vQ&RIV?~fؾ%_'l۪oO`:&޴z մ%&ɩM)6&ijWƗ `S&$$:;ԑ#T5[gNRQHTe XIʙP|F=xMř΍_޴iO(y NSX`L9Mfr9wvX)HaNz0bui5cںojQl&߶- bPjRJZfFjRfffc ­v'8O42جL3fI̒u$'KkVuWI$I2I'Rv}SmT-=٢nĐMVuJs6)D26Z6k!weΓNk;2<\i{yڵ*n-:~26H?_sapul ERK;8(Il*;T#N 4"Tən): ;`𪹬xN#憙)q֊txNΉ]ݪ4쭟FGyC^|p1_PضU`UuuI.\%Gel+[TXSTjYp4cozwe5A-^h˟IR÷vJg4{w=E Ë]H%wsrN;4u65FN:IF{GΩ1h\g"e#gt<3gt %RP-dO,<,bU`*ѕXn\8t`}*8 qңr-]lm5&ɹl]E=,VTXNJfhK!] JU}b4,X}֒0gl+E\3gڅƣ,k֏w-nź~WXtRc@~T_7Tnt"$`c=A5wF vl])ZRD=2S#gBwH᭚}׷'h𸸌/w3'CDc}"M~ԹPRTX[im.HamiJFtMJn`ԂaJ^tkLks.!WEm#i*￶mU1bajooY߽O|!ͱ|J5'Z~u]{)B+iM~V?`Cb~k?O7I~[S5t:HDٍz O%Uo.ʼU +ہ~^/ QPn 浽rH NDy̋R1^\؜ C0>ABm^Q>ٻB 4Ơ\:Zz:BkVF6̧Zѽ^QZA9A>23-5I#utQ@84Skasswt )_nҚg^==4%]iɉ  's.d,>+*ҝV<ưӜiRFn)Nz_M7,V.I zT"}wm5Xͱ|J5,O-M?R/U2"ݴc>ٶ/W S{zԟnue?SEm#i*}l_g>Wo|Ʃ F.kSK~&(ξ5&lH\\3$:Dyl.#W|Smf @-hMOjs]ϲ8b:qtٜB^u[M C^hpHٽF]Mvn}I 着t6*SKCfhf YAUCk5V%Wj'-UkMn1c9Xtkr]VNUK%anos;w.7e@vҿ(7bެL*]"\,rJ'NT(FJFi ަ0cAvg"2P@Ұ\(}^pki5<4{ |6<ĖrmL˩%k#J ` ]WȍՂZwcQ \v}OjTy0s&f56jU35M=Uۜ6fӶpM ;PcXEjb``c [iYNǺDb`idN'Pu`mm,eIffڽ\܉tP٪ҩQq t"G.ɨԌyÄ1K1X,]M +cn*-7n֘oQ H8euߔӪ̌/,lPFF CnNnIӝNM.weզRnHƸ|N\jd4򍣔`p' pkλ2Rs),7zi0-p1n2h'Yhp[h2i-` c@wȝG" S'k;NWZ7 Nҫ−j* ˉn훺SsL}*H9r>WEf{LΏy*Lbms]*}i+m%"\j%o(IxFoe$|K8_ LK\]Mcy¢nze3;g퉣nuQ2Tڰ4>OKc"\G:-YafO&2$ -I% =Ъhهq{<FD $HńVk͠w& gΕt{U&:RI.N@"@ $R^:d˯ҟER"""""""""""""""""""""""""ިL ~YtNpv]%"iiJ{r ̟Ѷ"QU=]u[Kc@wipt;WTp#/Eig;0,`b3~#U_js@*;h{q9l۾4]͡=ܰ"%(|2)]kKԄL4VU%QpI,b{.rͲ^Ny7g0}NwzZ"iKsTX i9P[J7-3FfI"{-!R^u-Jn:BCN|ڳK(դג U|ڧPx۹yen}J'H<9mth]UoiۆW?jٚJmGМ|2Fdnp$dow RO5w8'n9UXJF םVwZm&e>dρ s2tڮA' 5*enMڜ{LKjL$2/$k[Z  Q>3qVz׉90@s?WF|f^ R`.;vF~[Hj vmN%q51.-t%FC ,'ċ:C7zLO2ڛ=ڪZ83A-G>r}!vFRR$ChՊrKY-M$fFDx#"6& ۘL嘹Xrpٰ6u^{P][Tj)DT{wf_^BUNlu:`#nF]N~C[yCܭz/=?ZmU: nErO/=?Z~Ũow[Em[\nb;>ΘQ!nqI2PdYx8Ԡh}-߫Je8DB\[-Npy# DFU~*B^o/Т~-C{+sjCCn,R2y~Zak֙́iITm9&v "Y}R)F~ Cr0f̶6d{b*μYw$Ա[+m7L] \Z %d5%,B"Q^ x:Xc\6kɇQn[$AVU: nE_ס[ȿpjmU: nErO/=?Z~Ũow[Ef=oj}W.E-QPI.2*G-FxJKw\zr8,߽ Sn0Y0Nt'r/kw//B~amU: nErO/=?Z~Ũow[E}jwVAHS 7Q,m,g1E%2FYF3͍'w"V{ZH wjT(KFF|PPʾ+v*F'%!o+UhzVxKd*=o%[9NiZh.NFF6S_^_'ܭz/=?ZŨow[Efq-wRQWyr32RI:[n$])>Ͻl>3FUnZ6 ȍ7.n-D_I!Ry{VNKyGY39:|I${V=e:?!rMKj (#&*A$dk[[yx]'u;$f4;UIοWF|f^ R`.;Fg_ nB{YWG˄[ dG_m¿ޒR[Vw2c>5v]ߦe!uRfbMOGuS!*ɫp)Km-8 Bخ]shvG/<ǥa֋hI'MczԶ7yFDfZQ0%.;VPkĦg\ ܭ#!6z\4MFHHfjIpiYS( f6LvyFK.- 5LIg !*@VcLrcUsC\@r1ft8;EEB]%"H\Jv\}hpmHDw% #DŽEtT۱m7;ᆓX{Ӵaq_/kw//V EYZuWcwt# ̘j|xVYEpRQmGIZw.vCTz|$d:VNL̈d}93 UlUjLyiI WԝM*aƏ0M=UFF$El2?c5#ټ]pZ#f{]5 צf9-l'NmM p9G%Nmo9B:P펁_1lAIti"[H&LZYS0)})[oKp5ݿJ;̴MG?'.Q$cge3Y.ZJ:ulsR"};MJi[ą0-ߵ V+m7L] ZKHu&:ߐkwyNe.x'YgnV:wF28u;"_W5;-0]n]Z-UmJZJD:u=uW""/ ".&|m'rzJ85I. }B,z 5&D0JQ/yxJuPZmqO,v4Tw 6Ň/U>ǩXD1 0=Ae'fIPS}Jen ߠ-'RI r*)QhrKiN0ἓYQd \#sw)d1ȝ#Cn|a!6?J}2UT )p!='3q3\D4Iyѭmc h̝QeKr=MbNmFI9HH&G=KKe$K:ve{ ϔ2+k;@}+\7&!֫/% %k#' nm>slG(sH.-U}pѣwCRNYmN(ʷ DY_c{r&6Apn]c:Bv0A`Ȟ9:V3|܂FD5p_uקwc->*eqǒdFܖltB7?w\-Սݳ!Un[{ˁ#"7S~*B^~o/Эd_z~wP}J֤[jv, T Cmʉ^g!'Ю/s -wU\$ 1Ziܗŷp¤B2#뎨M>U!JҜ!pg\|w'XŹevDLM;iHۗzHۼGJ}ܬ=0f7H n ^ivi'%3rҵ2jpKKkmG!X틏 `2y3Olu9OIpo[.1ƹϵk=RnI2N= : #.Jte~.5,m23  'MVԨ`@߼>R67{)ʮ{A-"*+Fز嶓Yb)&4q$S:yណ#K#E"Lù9*WQ A''"_wM; ia&gR6F7xXVۤh Du6d-7YC66pz;#PI:}- p)WEJKˁ2"= wu z%{BEW?ص o譑MnO]f):T |^YPN2D(K<K2 Ӹm]B-F2X3bsY>:Qo.Zr,m֟ER"""""""""m>(oiACǏ1\-%hڲ yGиf-tM^R؍2#3ALɵ w3xO/:Cclyjnkk Rf/DPzg,j ާM&FʌtM$] tPuQHw>I\n+ GB[2;8A`*ovoLl\Ѥ쟶zBGoQ[V?j8AYűkH#c=kfK ]Y+0٨5FupYxhL'q )R7sfgDew⩈4n3<ѡ*b*!4 $V(ܹBNQ']e~XK6SҤ-s9f7c2@$"I$j^ud=.$u)FIZZU i.N!6TE3"2yIlDgi9]m%g&$n8etf]"SQ(q<:Zd,=CG4s xU"up}-Pdଡ଼:c}d]bzfeJl-%vcԂ2-N=8"2y[j`h`D~zhϖs(WmQ{ XHt+sU4[d>[GZEf֧.Ib;:Ġ찃ZRiI G +qG-3ͨ۔hJ[gn@;=:Jtf= 8lb^טLΘ2J fWKRUDb]LZĬEC hA+1>]`{;ڸ2,c:\dI E1.˶4VQ5U$yVaBA#MP$)"."dyug-fg]^[Xg cnlzȸ)?a#qi-\kQ =D6D&3 vnjXֽƦ6'e$ȈҜ<[Y+I˨#`U,t#5X +7Gdyʹޫ ޶hS |*= P]ujYd^ %32A-dDj3qűO,~)ZSH\io%YPDjqP#54*>鯒Bz2*Yy=Eچp0II-l׭Eܥ֟MlZٳT3<m8Z^mQYzb]ZupFA Em~D\J_T7 4ͤ'8w)21h-:lu,~wRv&"jӸo:Lv\ JA<%J\dx Kme0XX\S u[?ʦ62z { fo߶j'S) n-n,V~1yayZA xG@Yg}jcd6{~(-" Eز?v?R?c%4rfO+yZxQH%6Xmv0pV}QRs$28k “˽]漿SX/^.GͧYk|TJ4ۂ&-6CR]iɚ4wdDG(2" :р\֓ъyF9΋-ـs.g?B[:b_c(Rojj33RLkdo:cj1]ב'>`=2<AX^Լh[U>|xgtg.kM1xؙPө-'9mi?{?Hyꮞab!Rn]>-&CZA ,賊ֆLLzhTi)l!40EkAgČ]Z sшrVnk>3Vi sQ m#Is#H@,{!cLݙ9γʲl4@ݱu^Zq~:i1e_5z&UOaĻ|dKAnq:hs$$`rDEg r cf]6uP~g0?Q\NʫJqOL("Hqg8JQԳ\Tm0KckbGD“t>hඣzNA VR#H=f5O?FWo;TYR5ǛVRZbصxQP'G; %G*`::U[8sP>Jƶduu Tg[RyGR ҕ#w=f}$FW{MN*\N{CFs3*"R@1Lua9r˟ (yIޞEWDi58*BW3h#v3FhZDGYHE- 9y!Q $x}\9c>F Yh\ԺJS23&Y4LqcYrtEj-حrR4(.erl @0|bS$*ѠRlv~:YѴ.Br:V$kbeKNHK3-ƖТ?v &>Î\cb jˉ2:|1K7(\ uM>BVUZ ~[#N/6ꏣ2YӘ{ra\ W3SAX+(?_eZ4 ;Z98gY}s c1dIgĽxw꾐ӸTi2J8 =(DgY 5QL)tTU(ؘ$wsUj))Hbˋp7o=ʕĥ8gnr^h~f{v.75@`SSqֱKU <,W hQSpc|ZO&fD.eNF~w=DŽ\9׸fViylnj9$Gy;JrgDY?dl7._.HןER"""""""""m>(oiACǏ1\-%hڲ yGеnX]O'U S㼟sKy'2>$"1ي2t9dk^vOf=!>1Ϳ)O WOջ+֝@ ?'t?,5Y&N:zCc=J7xc˶NEUԛta $S ^XnN/z nkZG,OTn-"F/z.%qKX<%A? 5WivU. TAO7kUiq9ȸr=đq5 Kó'+ԩPiy$5H?u5KF͘YWi JHO*Y)tñ@8sQ>۱賢<gqY5vGbݥef40/j)Mu" "L퉞%3P3ņ21FQ[>63-գ>֘:ѩ":+еͭ2ʻ崳$xϒHB8$ͳӝ+ cRҿ4U}Sw-Fc5=ڳáհ9ȷɲۘ#iTʗ&nUp<;qN~([OhO #gFyz ?r\~RsW,l2CI~9Ïүjԫ+O ܅qSj6a6ˍFЮY (Ⳃ"[iqԅ!}=9z%Y5a3\sK@La?ZfPj4ҧ\.[n),KlR$J"3.+[ftrtO9BPKwo^-VgWi1bתT8)\'a-rZx؋ZOX7`vвX' huƷohQ]l5=;+~R5g!g~O˗[" ",T{_i&boF<.Tdzo}h}{+gDiX]M[:vA5.QnOܭƬ?aҶWeӭx߭'gӺBU:= jc1D.-ܭqo,0Hui~+~cWΞ䱍Hf*eiJo>ףx Xc揜̼-jDe1X;R~$A_'gz?c U*3&D^WwwZc;LJC TU*3:hadǦ&LsRywחk~+ oиB{3USX? s{VkŸ<}yd^S8[J M|e)8#".ikwY蓪pvNgq/ ZhO̴Ai}_ε%]rJ%ϚX%HmKǃxѓ/Dt$7 \8:&Bja =1LϜ]ݕW,C3hk!sUWkMz08+JЛ6T"&6\?,ꍧK 7T^ѳ žg5XN@Y M:)E,FЕ8-Rsg)F \M$YJ2?{wwy=@7*|h`9WajeOq=ض!HkɒmR\)(#Y+mELי?DIK}Σa>ߊwB[4wЏg L04|u?8^%xrQfYJa W:$@~:O)\~'Hszz ӹΞORx& yYv]ss!a_+K؛/AVۭUkH֭%[hV^ղ4r]Kqg#Rg"!f . cJ)j06n?V".C.=&!}`4v`@%cwv* 1<$Fx)ӎږ"5FɚcKaiQ5}/gZiYe߉ =SԱ w=6:lcna:Qo=4 cL(\/ û}8]n9`zun-"Df--ZGLW/{r:qo-i_&ORdx +6&5:L62S/ 3.`mu+!z)b!۲BWIMZ)mڸp zT " ͇،IwmFmP ̍FIAqOD<@#zLfY%mWsrPE;yN*)%ӸZd5)g ƏK*(1qVSk.*~zVmJ W6:^SlflDm OɒN+8..>+HRwӗUXQ@9=p:Z4 I<a pFMM*z%徖ˤ(̒D#2."űnG(DT- $xFfuzoF-zISZқvRؗ)8ŎHvj*0 )pvZk|5F`_XScR )#V&wJ8u"䝪noH&Õ'P><HY#!T-0Q?@Y?تֶ&Xtҙ%֒ܫ*O;w`HIq߆|V3c[}~o {Zxp`me[ȔF,G1lsC )..غUfKG"*pDf^'t等/??ڬ7 2$rb )uX3Gh_Vz8Yf wsZ##m$裀 [1<ՒzZN2Ī,isȆp\r%eE[H2*["#$N|yk'ebkzS/0aZ.Tl曶#+WbSZ%R2N]#tCjT-rh4i3Ⰳ[=!*Eduȗ {%Hf;RJ<6D)^/Uј;@h>pYC4GE^5$Q/G\ My ㏚Qnvytm?e. y.y:׽ 3WБaSm1LH5XӤ9[*'>n>s٭dAeu "Ae?XmW6ӣyRpH́tgn^M,RFwPj6Js>Cyh"7Uh5;Y '^uo,?af2 "/ПER"""""""""m>(oiACǏ1\-%hڲ yGа=oJhۼC<%diOhU8Sǘ=g,ix9$IvCRUﵟ(,*qU9;aӟW]6#oAޜU8h9s%dc;|X_%}fՍp(Ӳ4;dXԪrlm۴UsвPj#!`o4vH낸[iI}; N:,LҔˠT acLk .`ze53a7#!3ʹNmI~]~-j7וy {xsF1_w2 mju=?gW.Cצ_ȃƻgkk=]? r* djOC=Q))"I! qf֟7sj(חVa/蟓%lt}/V`\- ?+Z6mEo7~H娗`6Bo]G6 Y5SwϵߌH\bp'ZOtU&s65nW?K)ܷ/ȴɵڐYP"fI=jl# cYN;mܴɘzJ}֞Q3L;_>m'ܰ+(մ07c5ݳXtq[y"&N{+Eg3oH4c9%KsDj=pU{LJctHYHYAycۻ=iT 3upV MlUDIJK*" Z;ӒcM2$Nq:"xAjߚߩs6wG : ٺRYY[q\R28Y+s]"#1`A >~} F2M ϧUx]wgX(W;ό Ұ)#Vu?& N#ձ4/՞ܳی)<ک%) }==GI06}ؘ!LW.ngoNՍ[^[Ab`A(\]l5=;+~R5e!g~O˗[~]*w维Ҳy3~MRiywחk~+koиB{_3USX? s{VkŸ" U^4ACz݆3Ml#̺B7PAGm^WP#GNjJmDE $~2$Y-N6rfD+}HͧncC˷Pno$w?Ӑͥu5O[yjkry=é")oc6H&|dkng<;#?` +x1gIqbZ{W>R!oԫqd|ǁgdj MH7|h]L(w9NZlkdfF(S6boCnOe1SXFzR%)/Y5+5ԼXTgϽa5U+ȸhIG$MB<6JEX>Ō'5ZI--jhc7t~*B^o/Ч~գ-C{+t.^:;OU[Oor2w`dKF+}A589sͺsDY+{ ;wHX͞IØsN)\yeA$[ț8͒y2LF ##m `qЕhg}r#B4~} F2%ϴ&/!I&ҴR:oIh~/)Y!(v^-JP%x>ִ4@.Q=_׿ڏ&](o`V5Wi]c4v-i H[j#(aFI#ղ4/A;x=R+tӲڳ#?-ϰ|3oͭWڔ13(ɔ.Kv).3:DŽzh$⟌Źӫ7꟱ծ8=ƛ!3=!$²rم6$tIa*k863Ǿ=:ɾwςr<߬mRS`Yl'ަF$sf㦜kƼi `T]y&:&9u]o^=fV`#)"џER"""""""""Z-+tUN7!Di%]J 2O!A:Ja ^zEn[ꐪ DTI>p"$onͤ'{njdc8$,{Mi Vy${W}%0iL&4)Zu$- ,)*JdbꪂADl|&pFY8ћuBFF^21TUpzܕgg6 &=n.$zJʅ5YF_>IjlZ~?JG%Eć}(s\-0wl6!2)8z4X2QaHm'D kT`uRO Oj5UQ@D@DXř!r RS<:*qř)333ə1ɮ-2rmqO(E))mm 4I$!"JRd`h @c(4* ] 3c5 U,8HӪfZH; iZWE٥R_<  /li>jLP`2 ZerOjUR@DXÖeY42$N<ث[YKR333d}mg C7:X/wwֲYԺmRڝ:5F$S(y 6֕$i#. =5B"6DDs(̨Xq4F`KmJD)4yl7b;ڍ&h5Oi#28j2c#Ҹ -@ATi}_ Ѥ{VC)*.ɲ( y*' J#y,>Q\ J>qff@3:̩FX%b7DpUTUjջ_6]SkjJ&N|Vddo9T+,Ff j6[;Шt]BAGZIRZJHEL ֙hw4ӵqY wIޣL"9OT܍->ҍ&%<3v{UNM:aA BƽtD~όv֩q :Fwwֽpl{.)BOxڑQBVҢTdx>2Q`"r#X#h02 []J+kO&i,/ۈJдR###,}>qgY깺Y Aوj5UE_"okei54񚒖ԢI(̋##]W1g뚩Ja ; ilRirZ %(JI-8YVK'A2~ԸXq4wrh{'84$GJ:{[z|;y\xnAV#_;Oc=-߽q>d8o=i3p Fww־&Dj 3r5;q ;KII$Y>Ii\M!FQ8I;ɓ_Pp\Jtg͌ra%B JТ222#!z3 16=LmDΌfdƧifeN5Zv|Q5^AqVQ3Pڴj[JS+&\<ԒSRDE>Ţ_/`w&7SU0pqWOtKw\Oo=kè*dkw|}kȲrبSm %:|S53&5>3/6fICiQde$e8nASkPC7=%eT덥 a{TMԄ>T]$#?"Ni ^*miџT{^J0Ü3m&9֩ ?][Kn&7{Wܓ<ęQ%6eq(FX1LzU`H2&!ck*)>leo"=>3NhhGbP6v|Q5"9n.$zJE5YFX}aIuY}jqRT(333>&cZi2$NԡnDDb1Y;"I Y~ Gq SKiEhR &.FX]ӬT 44Fk2dٔlT)>1&,٩&48ҢTdx>ƺЩ :VRn.$zJ5UPXǝ%lrV}tgqj:{[z|;yTnAJ#_;Oc=-߽q>d8o=i3p FwwֲZu2G>OKɨۍ 0 j5(iJK*33yq\= lG8̝WQj6-R?Ke`WC~ھZ` Vm.BeSm*-:RqhpdO2xi'ک{ [MJՓji*Lj(( EKeWsFGe4M )JKp"!ę̪ (-+R$VMbbPMa1!BL̒Kq|3:e?_LoWkLC9 |c=-߽q>drC7I(,9GE󜫍@d-"NRFxIzpDDc!'A3W&SktsQTs'NdWYӌHiM+mĒI)&FFC.k}#w;"[b;ܖs9PBGJ v I# {"1+*iee m;i $).""/Sxőwhn(kO&i,/ۈJдR###,Md3ug/qf#/U|AH'jJ[Ri'P#2/ w_ퟮj*eH^X6Lf|zmIǪ5Mj4&Dy(m$gY.'@:NYRmaʥ8HВI+n#qu[=tD~è'9Z'AٶyNb#F~SPi~Q7QR]xQ=dIjbN'zLk C=DY̐%ǢI+}ӻ%@қu\Ez:'-Bw9^ FӢZ3uiԫ\99O+e7Se*D f @sԯ@D_n[Cuor<+Ry=onrV3YN`Y_ퟮj+Cx"w;I-;BWd$Df2<(BLȏ9" 1θ6dc/}h}_ Ѽڽ]2p*H.Mq2Qf \wiU6FG0i |X6EKBhQi1iyRM&hq EˁN5Dةq :VRn.$zJ5UPXř!r R\S<:*qřKZљ>\'J𺳶8ڿ=-߽>尨==ᴥ羱\%"5UN,Ȓb`IrZfڂ-~ZhWC_[Ǹ|ͼfŌpe1'ZÙnR'=:lgjb mu`ZUuʹ^$6ˎ7͞ϴs+;xF*ֻY.Jti8'V?NN_Gd,v3(-4Jmo37 ެb;\ѯplʲ ÃjcƤ qwX_~]$M7>SmNnopx~-djIQf'+_O'/Ue/ꟙ쟊rr?>%S?ݖҝMNUd'Z>G2ӻ܋81E}s?Yiti"6R,9űuNE6?sU4b3NZQpx+ '/WE{L1dMउ?3~mlžBdn2}mTŗmEܜT~p< )mmI5urIWFfm)*R,CK+1 ݳ~vo<9]1Xme[)[c[`ESE5#U6sjMeʭ$f\|2|OGv+Gq;!y<߮]eKS I.]e*nbE<%2$8\Oq#K՗֭O?e4+H'!ݫ6+a9Wo)IeP#q?J\$?]Wy =cw( LsLg:i%)Ԃ^Ue"e^)mұUwӔ,閍-76(JKyelY!VT:e(֛ci:ߞv,[;"O?\]T* wRYȿp?ZU";8X#=k5GNK+\MU=q)t$,#JUxdRd-cn M8\ 7'57UK!B4C_CU7•Lrqy.sͷ0ڗȽk`J}@qb%:e9Ï|upIoMcR^Xgw:yžN1%> :"7յ3nr<6qH#i__a^sZ[W6ySu Sqc>: w5ǩ[)IZN6A[=u2Er|լ͏sZYy>#];;w"޷ w,Vsش%_z|גA11廀=eخ6]¯ؗ铵٤ڴ%⩱/&)$ʔ3p3Qt de>Yju3jQڭ0斘9c7[yJ*u&$6p8!&dDEʌ_I8[G85_ԩv+KK`\UںrJmRD#=78eSN"ejy:etx(>yv/AھEkEGVKOQ i9#NOԩPXݷ>]i;>o]iOv2cinK>'#XjQ,hQO+HsepFV \DNPurr?A'>YK'uܜODTevvУ]қE"5NI8)dN[#$V ǂm$N5GXnp7jvS"*heJIT* ZYHNpy5$,)Y\T-{]X,|suSfcAX,}G.B}RrZV|:_BESV,ҚM5EhEE&U!u/7IC?J<Év'II)v[o$AJů+dH#t[CSսyˋ,_DXS

/fڍ'1Hޑ}?Ȩ8118ܳ'-uj'7дurr?[%S?ݗwR{gtoV]mFcczoH>Tm-&0Yի fZ)謓:$ILDY3\t1HA걊4]QNr-ɵlrV1PfHUR֧r,ܗ|IrkV׈0O)Blo~i[W] HI-\؆`xHϠˁtcÒVv,O=#ӟbhpGQ]kc_z@FH$HwI23#=sB4?a en=%ڬѽaŧA.׾s漗7g1Dq-.ZS^>>麽\1a:(Zo[|:_9}ʭdRvȔv\U))D$9Rcp.g!cϰv֎ Tntޟhtj2CѦ7>=q> .## G"-ZNp#W 5U"6.z jatg#UCe9L{cYŦnDblq$lG.]M1SLt1VaZK%Bir'8;̺6%L*,c:x[Cdn6jv8بm«#9y¶wqTL$l; ١UknĤrC A|*<|& T~g LTۈw=AHpku$ҹ8oӷ.";}ʭ"O'. .y3 ೌj8q#›eSmHM5 MmW^WߔH CRJQnSRi ׬ҫTv9`$#TmU8c"I9$mi_jChu=^[qg\9~Iog6K3S@NƼjeH$fM#,17oW=N]|y.ot+c[\=hǯ|sbt^.lg-7/ܜVEzTdV?N{O}?ȟ/ꟙ6d+M>szl/y4jO+ӞV~*LጴuRqL;qb;#H;SܜJƄwt+O/{\J>/fڍd'1Hޑ}?Ȩ8118ZLa'.ztXMy0yDIQGB*AƠmXZ\`fJ䫻jcJ~%Bn{---d\ ЭFe!&rj^ok 7>]Օ,j9gIX|o&JV\R[R#|K8qo"~O[?/=?Z[π9=WRΪ[z Ҕ*4ӤlϡEdgBboFð*e*''nFv2m}K+kuoW=N]|y.ot+c[\=UO}Uu{buP+7i}rҨ+\,՝!(yefx-XNs̸csl2 &#X'ޠ#)Μuv)w͚N7mkfqsN}hJ%nwwWL[j? r87گ l qi>cQ^iO9h/d%ؗZ9/;y8Pk'Zqp6>ΟNUhe/k0Dt\܊z~`~,R# l'yܺ(oiACǏ1\-%hڲ yGйD(sZWZg3 *Ϟ 7MfKR_cxɋlu:ϱc` Pw dgOE~WNs0[a]v&Fg>".&gq !5I=_ȮMOux'cVӻ.ԊC%MfG-Nn*҂%JQbq;RύvsC4u3JoТ U)%Fi 4Ge2ҏzvM/:6 .kgw *Ɨѩ09.ѴڙD:O.٣Pz\~ɩ?No@Rԧ B|d["PWgGAϘKn&#COl =Jw:#-gH:ߒQ%gzRAhj[?ja~U{=Pq~Է7?i6e^]/^6~h q= @f\y,ۂXk0j%DFCqdE54< ?p]iVPwc}TÈއ'|im%=Z6Ź ~lӿRJUH}%3Jd-"BѤ9AWH+*4ZA djzTz{ųe5pS8[GA- 2,+˚e͈ÎhWD</aÜw r&DϔEmC׸  x#q_mʥ&wM-dGМḏ>cAƹBwqT u; Y€}llƣz9@ܨófJnI^~zTk7CUsaci2uƷoh\]l5=;+~R5g!g~O˗[/Q^hj_Ajejcg(3;zжQoȔIfn-Id g?=+ y9Gd}̻&QI8u;ك~Dn oSb^w;+nX@?LSԞrB݇1sq$QyLdG2D[ʣ"$FD^JI4`0gLӽXuTyu_ C"YiE;3+ԨGPaQ-8Rdbfhs;HV;只5%vmAnpU6r܏ "%D{Lx2.C ',ή#گbOw"t=}XkMrԉԇslփyL':j1 $G( V}vA7đHYNFHF1Hʾ,zI3$4es62, JF|Bn"cNp7mԧfZ`AO)]mj5L$*E=PQO{Un 0t%Ѡf$]d.|8'06=$q+:,͍$v?C J*V}-U3rʌT!I=ԍyIa8.%[X[vC(=9bKD#,<.A9L.rcl+I,-L"3q!Td%Fjf$f&dK=$ge5Ve8t14״dm:(>1fײ6ԫS(*8Ѱƺn{}Wj6ezn+OG4>#2T$fQgBl0ƑV{^5穩=u)pFA Nnչ`KMZߓ9n4JV˂IE`t6*/sIH"zS:-k c-0++5y$A9D-ٲܱ3ԒR33!<Ս -86wpAw {ѹτ.WE>B4RӞ.}?k@ϞV50lf]? ӔfQӵ;'#e(//;.=ҲȵQښ%&ӳ(Оm15%ڞ"?ı\նi4Li۞Ӱi83{:!ӚR֣=l|@k2Ǐѭ9Ը+%8&_47ذ¹󝉲ϷHܲԴѳܸ鸿+*ݳuԸ)jѡd¿߸锣#,∋ܡۥ<\G..#|#JrK1o' źOW(w6{)TXtm.I"QL̏8^\DĉٗV2|s7>'mfWjXioLH‘85a2(.)V\ n <xYAڑdt4irhyаRg 杆 O|Khz\jv5DR -Tu>gɸj5UpIK'Shs g<.qo| aɶfۖPFfy9۱ձ L;ē[4GRUɻSRR(VGMkrTmFgusHȨ[jtr:nn CsjƗ{Tˊ1̢ͶgJpFN`(IxMEdwāIY"dTth9h0ޮ#HTHF'fr4Jɹhcm}*\T$җRR%GFx\Hwc٨#hwHYwz;@r,~}VL/psLn5yWҒi[ 9,A T?.+1ԉ'l[w<}#%{P-.i=isYmU*='!'o*ll[w.]zަVTdhJ$BG8;K4G +U\5'Q5 H7 w9tJA6-+}v=pPe= eEP:/]\x#/WXnGN卵ly'SN(z&vh^O[jjՂ)5m^L&n> 3O'UZu]?Z*'co6!#u`5S  ]ُH]h9Y+jߔY<5tv֟Gqbx{VKogS;^荻MqFLfs3D2T\&R,o.CAnۺ=bk\ ؜*|mtC#Fb'n:y,ELKK-22JPyȈFf9#?b36DCl|V;E݀H,A\#zջR]\ѬtdDN}}ZBx~hK1?A*if|ѓGX3ӂQu# Oh^͝_ʼsuFyʢbH"\s&=#= vmkaU/Aexyz|V Oo2~s]iCK*BM3JM(ȳ!qcH=sԞÄv8 # qXju[Y oɉJ+Ce$`\:WNz=pIp1HǃVڕ s"zUnXRۉJIQdאɞiO;޸ V;=6}qKSw)7Ƭ?pwɇ;JQJQL!N6HSn4qό]0:ӧ@A9ȳYS8h&ɭYus+ͱUp`%ݠs. Csj͞Ɨ{Tˊ1̢ͶgJpFN`(IxMEdwāIY"dTth9h0ޮ#HTHF'fr4Jɹhcm}*\T$җRR%GFx\Hwc٨#hwHYwz;@r,~}VL/psLn5yWҒi[ 9,A T?.+1ԉ'l[w<}#%;Y.RTG42Kw׬< 5? DSXR";)حC.(ˉ%]n Û=mެ^&4= YPNGRGTIUM%U4M ^\8z -stsx:m;U1vc)yA;V3f6탼bg# oGe޲NUGe+@D@D@D_՟ER"""""""""m>(oiACǏ1\-%hڲ yGйOtֻS*0RDvti4F$LyxH q$Oct[?Ԃy ,i#'FSPۈ*ͻ$ȳ"_qۚǵr gz5ǧV{G hhͤhݢ>2k3׃*255nAte1VG[I?]u4Fb6?9G+ի1*"RT2>$dpeddaj>ũ{|ׅ> հʓ㝱"5/'Nj Ru, ==&e h`io8Wj]whlīd6zB39'ڥ&ِ[2ߕ!ihp$ХDB-P2Gyw]B3 _\5 ңZT(ʦޢ&`cǤd}ְ_iQu{lM]x)?v,&ЫqQ4Нy w=qN<]xObYӇ3~2k+=CM#@#Iz3)^q&<6POqƛ֖xɠӼ[.%*17}7ZlnFbG!,Rht&'|yֻYC(,H#[m|OuDd }gcBdscA*sZg կAFk)E3Ś5F`_XScRz)#Vm&wJ8u 5{=v_8v6?9EoͺԻv,ͫ=2 RZJjZxc  XcZ:\CGj ezfif6V/ɛw1/Xe47;JꝇaAjœ>[Եdk!V`g) 3rh,.XU \ʍK{뚅//vO Yoksȷy3L]Ņd뫔{m?&3LMtxHIqZEk(X6ÏA0X=k=HO'foK.EFbVM%9z\A -2,bpuo}+^UhY:fIF#MF2O% .$\ i[Pw3Ӣh+695WuDKIW#Wv~ '(Zr1=̴MxlU{Ɛzyݙ5%#Ұ[^ ;~*3aLh<) z0y‹d|D=9` h+nF٘z#n[a>mنJյ/ݲƸ=<p6]5{vJNXm-E;b¯7Vד$=fdYn1q0,o²F2iar ;RgT2]޲UikaU/Agxyzo|P8'?ՠ싷SZE^EQP=Q=l4]r;Ď"h 9NYRY 9 DemB[lZ :|+jUNr\茪Cyho9$!(FOR[%V{;Zyq`r rod9)WK`M&iv1&}J-+搒yqqV{:o)GD]DDD-Ʃ$6~sW%QljIw@]mZI9:fL' KIB}T5tV}ާI+(Բ-RE}:~,ˈ>+,yi:E|F W))j ?=ZPPk G=vQ'.F5Tʌ*9:M+Q&/r^!wyGIX5 HK.oZvH :7m'6T5 nI2,ȗ/!lq;6ަ~Z/ci7hmZ ̋dyRM$2Hh\2 i1:w,*sr ݗ.8r~ϩFSԣ6L_!)I$r*>YPk]aCۚY8R" x9JЗ-xYN4w U#}{>)-5k;(ɨpL g'I`{:a2{bm̡ 2Q}r3c#HqwcG׫_ ) ;@#=fIBjQ""ə=G}LaPXYOf}L>qj4tx[0FӐXTvo3%voelCs]ٴޗQ_ERUwŜ?](ZuΦ @=Mk2 .GilN{Ji"Iǜ]p@xO$%7;$c޶T5!i*ͻ$_,Sאai9wyOԬ֮QMZFh#.e-6BRxv6?~cO|jogpS;ղor//,7E?uxj*\)AG(Zx?h/GOQ'-AjR/jkd, s۩P#/]o6ganB9!*u*FH+5FǷP9QR*U+%MſMG>wKqđH Ad}1i{t:AH\*Su;Xw} N3oSǰI{?m;|V6?j%]X8Փ[AcGjz{.BϡNDfcSy4Q,cd.]vϢ>a5\Z݀qꬆ}SÉ6msfkq[y5j Rj漖kSqmՒᤌ̒xɑgABL׍hۼODHJy]McP#" N;N*7[?I~R [߇Kl?7jsƮٮKiU1J݅:{O&BIƇRtLxv@}-*rx?5bW2Cט[Z+B'wb1kFDq-M2=%_*4 %@ItvEg2Mn*N2"e4fp#(xG+ aR sɿvk^" ƻgkQxxzO3}Anڴ!SXz!{riiF NwE:@r0>bOXr8~,j:1@u1#j0WTԫʝ义շU*rHBP,SK9vOI~MߐsS6@L`;OoFbMJd[-2W 㧼άufX-(sU؏@]Njd-&IQujΪ$_]?S9ݾ/G5g7wv8WzEg[z E×j:M+JBMjA{$׍Z旸2y@V 侃H#.ulJ]WV5!u"$E0iJˇ$~VzLJUA.GQؠ@Cp`hsDRB ӧ)~~˩cښPod)MfaA:o"eIܳ(.%%±.ܳK$멆!!аUl􌏢:ڳ&-<˂</$v{SRxY3ۂҲ5.(oiACǏ1\-%hڲ yGйwIGؾW>u;lnsmk5og{9F] LP#ڱ \#欢=هÆvN7-ܜW/EgTekUt^qNcJLor/ kF3|B%C~ 5'Mtqk;}GcA? pք۲BWIMc6Y |@Ǫ:`fJn#v6d]Ԓk$DI q*nݽZȁM!Uۡ%bEC'soУ0̌GF/sKLBTޅӛ+1ӇI’̅n;IgGOlzqvFIZ= K7hh;џlZ+.TV~Tj=*>O0ԈV۾t݅Ψ13w-CztWO\"FdTkY8| Hc9*Ad&$h;vwD {r]Oe ?g*RҪIئТ+q3#Fx WPƌ *O,o%S?ݖŧW~Mgc|G$">`:E ĵga#cU@7lyOsZ9s3w.>n%y69.SRwwǶ1ukyAb0r9:= / isAFԟ}Uw'>찭-祚졵U>Ͱ2ӻ܋81ǰ7ڱ1MG#`Z Auby rM~|gLIIa)nBisGYO򜤫uzϬ:  sW] n>'VͿ ՠRmvy&2#J%-X"-(1nV5^\v4dK?u$ֵ*ڒI+*J⸒U7-q[訫)!)?ƚTȰT1j#Xٷd xWu*Yi15$Mp(0R j3ݭ$Q.W<<]evW^M@h?Rn2S^[sԚY*rL[l!FE(,o,O]) 9 $N]p&vfW@f`3&=dpg19r=U߷FĮit;Q`n%΄Ɉ! WJp%[JFxC2N\+ՊK~ÈN)m` aq(:ҪWf ש SOGu{fIw^G2<Юڍ0r#C>R^'" PFKm6zW,AjUݪ. 4n=F眕H5 lm7u,AN[wI\z4UgF7%j=0ӊLG&^*̏u 䔶y,<䳽Sp1F7ojB-̝ӫm=$N&٩m-99zWm땋.+P葐]e mm fxL"ꅕStIIY(8Ew7p-.[hVv#zq1RşSdR2ˆҴp3#LyCهP`˞|lbSD#,mh3hFbHY֦WPoG@n"r]xVS2Dg.8!2&b`DfDOQ=jR%DL!Ex>3DiyYEH󯩌W 5%Tqh3RFz eS):3m(@4W^ms8#NQvtsN5尩Q$j7a I|ix#".U*fuZG!9v۲sfm8I)Q Iݗ<XMpd'uyOK4ಒuIj?zsXC;12<7\胿^=85JP⍄CzD޳}Zivz_mmVؗOv[Son}^zިL(mm)F^hm=@{"0?gԦW~21Z]aXn+kWߡɣO԰;kjlӼ IZTK<nl?G@(=GPh^.?>QzW G2u]wnF7%5M.[\O8c$FA֯x;! up:SFSN 0ق©ŗ>\/)7ٱ< ':S>/ip' uӐoPE1{r˘LB|%22Fc.,iioӇuISRGpP֩0(c'Ȉ]f8oyAdJRL&;H靊s嫈'#ͿW Y7ͥwpOiԠr%Igʷ-\hC:Gg*=%dc;|X_%]X8Փ[AcGj{'n]l ŷVƿͧQPG`rlW.kL&]ȗ5:(MY\f *mFfE#?|S~-#C=T48xyf0#65wܹSM5Zf"$dT)sG2 \GkȌм &F\  {GqNu<џYY=rCĂ9uRPbڷhϩ*9?dB6"Fq1/'Oyֈ̘7F,㈍29bN2LjQW"ҩQ҉ĚNSʤ- <0j2&*qL-N˘Lbcg";%x?gy;o_ /6,3\F卫kaU/Ajxyz ^O3}lo/6Yz)*J"22>FF'^ t%VY|Z}Nx-XN]9*խ-J*(t2|:RgҟI=ozS UdFAS\34aU:evSiW2ZS_8",K. mǶ{] c(n;q,*m ]?ټsI﫫ܯNC+58=)Vyz;Ýݥv5hom*S(Tr)ykJRв#ᎃf^RoeH¾yt8rѴ^1y/Ckiʪ4+r\Shlԭͦ([9x:=2|mٜsRߌLN@^KY |QS Mvg՟]L7]7cz0sre~ JS’̅ kq0~i*MS6LrHX5f |z3퀹CEtʍGB'v}ՒYN\i+3:<{q7=Yu=e@͐I:䎉Yu{ZB& ~:T?V 4іێRP"d,p21']'=Ǹ6NylY)pp&ԋvcT]:\rܳ$'"tf~"\G;s1 s8<I@v^2!Lh~V}dnǘZ~!V x֬dG⇝V MIgcl:ZiTFii&NY,j4fVLoX-q{wRٷ[BU!rT?mD4I{> leLF# zeZYx<g%RdFD~%ޙS+jrSy8 2ZBDUx1quhI:aIܭ:hZї!y> 4k3g,Gq޺Zzi4bKs9ʥi.U>"#/E97^1ƳA3c=ܸr<;%p{WqI ?$F1+J]J;')RT̎׶#Psv~#-u#=Q͐=K6.v{3pzʡhm[lZ6%RNSi\ϒd\ g.C|dny96Bp胾tz2O{F O.fyН1]->mz [Ida[Ͳ䳅fY"">&BKK#0##B滰lGdkN@gtְan;klzl?,/5YU''7ڲ~n?Hzx4L%EowUTB[JcYi[ nrK*3r-DmGGA3`h^t1U _3oEڷ1ʹtERs?w>-hجu?8^UGe+@D@D@D_ןER"""""""""n:ܽzw\}2ky:\m] >7'bGA ㄴu)[[;3#@{AX}/K/VC(⧻~pZ?S>tv=ޓ5CVm6pm:aD?SoC_)xg{?E:5]ggg*g`A9څ5zVAѭ6jKsUiZ&9kBWh셠q#XZl!,T43UZ5"g@3z:-K?B6]Fe˜yH1 ԣ$7! NL:u APgeG8fuv~Ut})54Ap鵗uäSuOAk:ZF7"ʲP:g/E1HD QrM3 Zv%c12=IM-%My-H,'*}DD}xO O'qee2\gdƼqZZteY,A$H(O/@ǖڛf᩹х)$".=6ӂmMfzTzFU$N"I9\h,˲ѺDk+K[di5 r0QpJhTpQ2(vH۪-{C]lgl@Tl[8" {AX}/K/UC*^⧻~/AjY%ZyjneՇc*5!O6,e$-$õ2(Cȉv~H0f:;+MVq<*Tuz|UAqÑdoM N *,21]#LcLBǖ2?}/K/HC(~⧻~vZ?S>tv=ޓ5.Yl·]ynq!Wi,ZӔ$Qxˈ^.gk=&8˗M5VԩƸˤ#(OE]^vGTzO֮ W~'"Կ؞⧻~Z?VujYő]:צuKϽ-o>]G½CY_7dd9:VfS$DvLkέK;̓셃Dffv?ǻbT1.p̒NgS2]%^nmKFpN˘89!I> |!oO4zOָU/^z!t% 0(H=f#Heң$dg.2L赞ҭyy'i̯8*"ƫmtvAo@-$IKBA.q{Cj6;=3^b%=OG:>Y GuU֒# bm{v׎OyŒP őo(1\N: fm֭k:NI>YSXg[hjC\[푸!\|>G.8ArQ8bB#.yh68'euHˊOixR{'Sv/= p)TF`RǧA[GZiJDE“\dShels^s_ q鍅v.ή OjfkPDlu ;JilWVXe"c|,jǤ\޹S 5![/;6~I#z׭tm"IRDI"t P n>/aU#l9D79m:sɗNz$j@S|vHRy4N ;ֱKkRsyiN_q.#Y鏩Qee2\gdƼqZZt}ܢ]t=*dJHyJ)*IHR`AX9ЮNa4+hѪ0Իq5{~;T' G$ddf$ SDh> G"='/zwiW]ۼ;sk{B[OhԄ$p!J7I'UQmXŜNu{נ t{AY&KѩLsZm.;qbm4J)G.31ʭSQ̓%}I3=L)ESD4QV[}IȒ=3R)IdϠsPFv' 9ors|)14hY˧6m*n|K)m&${DŽeY?0q:)Qވ=t*=RI`@{A^Nĵ,f&G)=Ĺ#<O∈>19 .4K ל6]KCT2b4.7%1DTi8;Suլ57>0<$DEǣFpZ|iJZʤI::mYvQ7HbVotV-2榝N 7C-iq)R [̸ڏQܝkt `,/Fm,LAܼVٖ+ӟhkvېq!j4y,ϣ 9LTi)`r۪Z5 ƙVIE#,ӡzT`QOE] vF8^>ھ?W{>i vH_Pt9ӶTcsgq6{'\*_Ȃz[BR ,%I" FRZ@K4˻\V:mchGGmޙ%FvjMVqVzQO}2Xq~L}GAj{'Rk_6C}X[QQ2x$M$%< )JHD(ę*K!VՈݺ}h_\òG]:soډ nrۛPu.\5 ҕ.A=]V& {A^N˶lx2iֽ7p9N<6j} VȰGZpi$ҳ<ꕢ/yv6F^ܢtKj4&8ʔqBI2[jBdeFBfduGV96`B8=ЬJ==jV6;wT[xt>hQEpp#3RWkCpt1 d RПER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""џER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ҟER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ӛeF4qcC8MI^L"/yT=/_(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8vgT%8S(=/_'fuOxW8ٝS"aN8ԙ*u*^TP(OyTՙ*u*^TP(OyT֙*u*^TP(OyTי*u*^TP(OyTЙ*u*^TP(OyTљ*u*^TP(OyTҙ*u*^TP(OyT֫T{r>_ŢѾDӱհշۥ)"LեII&<|sDV)q$P)izYeʽ::Sx\g}y7Zs÷&2{kZhxg&@%Zހx"yJ;ŦCu) o9z*aK3iq(S4J?K!3}I`XjQY.xhR;Hu0:7v}-~4}WhrZX=OO֪}n߾VOߺ|ez~Jݿ|E _u ?U->?pi~[)>~4kKǩZ}~+vϧR}-~4}Wh>֖/S3(VoO(Zi},_giQO>IPP_٠ZX=OO֟i[}?k{꿳A|z9ŧG>ҷo+|'BCOfib>s?O=?Z}n߾VOߺ|ez~Jݿ|E _u ?U->?pi~[)>~4kKǩZ}~+vϧR}-~4}Wh>֖/S3(VoO(Zi},_giQO>IPP_٠ZX=OO֟i[}?k{꿳A|z9ŧG>ҷo+|,je#/kH2ɗL>O q.<|>"-=hU]فrmzG֭4>k_nε# vmBj/R.6])fr[IN2iZyf<8/isi0;3%\lku mlQXN yKuJX""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""Ӓ:?ٕmKRk4*|ƪIvi~;4%CJ"R Kz Ŷe.Y5N緯Ch9ay-pIpȍB:NS*.QT#KCAR,JeA*p-=F!{GDDDDDDDDDDDDDDDDDDE[{-VԛVIwbT9m2f񖤾yVFєr/e-5x-#(#3ɖY͂i/v[Aܫ̱مD~3rfNYyVۨ+u{jM*R)DJ6*ͷyV21FVac B BkSS4A0Bʺ޿&c4WI0FM)3u 2,!և$FLf5˄'I3iNOA1lj^plYĖaӤAyDcJֺ߷XTryjގf^ѵyjUY%2SIE~03nڒYQIchn k48uW%-5j+DDlVnn:7q<0JeQ>+\&a;ipjX ߖݕ$rM&J(,L>(^?Ke> ֺ Il£C9}R!ool-HPZQ'rFV)I£/S-ݶ9OJϸfƶX=OgU3Ho_V]ڂձukD)mlxV E'掲 .,}V|+p֑td;+p^ xWO"fTk>30C&L-%KykqfkQ&ckX 2hSZ_.h$ Evl鮢NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5slǪ=9H]Mwyԗ&AJ[l =%wM[Ȯ>9IӖݵ^1вrX,<2eYMznT)t]D3w2j"RdLpY!=(4^:O]nfG"nqWh5A #Z*ֺ߷XTryjގf^ѵyjB " " "/*RFIROF\HD[N\7SE M'{tn,A}m6+ u|u;맄WV6jqߣ\$r ?hSsB[oC$v˸evz)Xޢ9p4߶ۺkS6ڸeJ'%ҐWt LidsW_^}o 9N%p-L['y$CYDyI $˙JeV ժρxm=+VJhQ- "RTA"2+|DDDDDDDDEjO{ʯ<$ؼke?Hќ4ɚQ+2?芼S)~v@U!JVdKO=j?hD e_oA~I>S)~v@U!JVdKO=j?hD e_oA~I>S)~vvNuصMyfL>&;'Y&+1id-KR,${*Z h! ̂I .6ZP|aK]Y\4`.%s1;)[t " " " " ")MX7"y uGں;6k"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ֺ߷XTryjގf^ѵyjB " " " " " " " ",ݿokEMvUHm[9nə4n(ϠVi{4'-:V{˃;wRckW%ool]fhͦL!ձT<$ND8ǟÞ-ư}ї`q&}#$O3\M0V6졼IngSX#z%i?OcOž)OԺ YkܕYn9 osipohWm;˯%,Gg-nç.]yw/,%}2*zK Bݴ225H"4>ّ-(+ZKNap"t@D@D@D@DXVܪMƳohTx')gSS!k[7cT|܋d:;+ojOCڎWhֺ߷XTryjގf^ѵyjB " " " " " " " " " " " "/LըJe.,7ag>ݵ$9Ȩ9(֫+豫79èxڵʰ!ԳՈج4tP8NR"?S/F_[lsןq%mP6z4f[޾uk})-IҳROAϛ>ŀ^7bI掲 .,}VaZr 6/9ScئݞQOgLլQo"M٫P6~a͢]MėiM\i7VsOxIFs@:DHgu_bxUK5ǃOg7Փo`~6/Sԏ9:~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO?;HreBV*3sb?o须j kv[S5Go]7cT|܋d:;+ojOCڎWhֺ߷XTryjގf^ѵyjB " " " " " " " " " " " " " " " "/*RFIROF\HD[J[7Jiՙ/s3(lHmA>X[wf_ A[{d4noܔ=n=^*ۑ$2fhZ<l5i=943ӸU\"JdαQDʭ)ksLN*zsRlN)Yڑ(^,Gy5`Vk铩C]U{q𣝖: IoIp[A`a}2AF&ZKfMpE6DfDIc%F.OfYL]BKӹajh4酘%[05XKw6YRԦ-DeG;v48OjZYvĦ@u-@D@D@D@D@D@D@D@D@D@D@D@D@D@D^ s*>Jɚu/T0mV ")MX7"y uGں;6k"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ֺ߷XTryjގf^ѵyjB " " " " " " " " " " " " " " " " " "/層~QrnQ^f˝jU ~K*2:H5nIVE2ڪ0@qN]Z+Uq- *ybDYkXI-LbH ;.j&B}6aDiJW"r*+? X>к5ts?D?Pi4[۲wm6ORd('>Q-y?R˸5ferTigh[{D]5z1GdFk w>7]I2qj:rחrə^7"X\ "UiuIEEV lİԢ( *PvsN@\ʏ(rf|vuU dSz=uGȾC^s]~ LSv=+.wM6~*V*A.ٻ)5!Le-ԓ Ħ;16}a1h~sHиZWDDDDDE2z _UC,Eo"ޥ|]Qr/*_y==Sj:q^ֹ" " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " "/Ӕ[F4Vݸ,:DS&I[`Jqn:-JtjQryRk`` PPLdl@.r$W/(qu#$ #>t~YvS7ccW1Xq;4m\{|'}W]gowK \S.H'CEɺ }E{@D_r|IA,@@D@D@D@D@D@D_T)+B A  (jn=2^'fQ>|)ڃo^}Kˀ]Y铽'Ҿӷ[4{BLօ8zA#W_^],sԩLFˁzB[/,gFG+mHtBS/gYpŒ;q 3Eoo[SD< $ L$]yBR9p4[I*JҕD,IRO$d}F*,TȮ+ʏ(rf|vuU dSz=uGȾC^s]~$,т%v'$t"Vj&B}6aDiJW"r*+? X>а ˸iΛ_H}BLͻ(nvؓ`H&Kr|1).VnvZw%Fz[*f)MN{ɚT"\ެӐH<*InE]?R7twv' mGN+4DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDEՙ*u*^TP(OyT:QjPc"3%:iY(aVh}bӼX@aiKfw"ƉK|d!NSsn:57j 7{O7T}+B7&–-+L^wV;S}=(4{"+ v ܭTV9"/D>$Jvt@ " " " " " "+`Sh>iݻYE-5Iq岇[*WndfItxqzS -a1 ypqZM+Z鸏FLPdH {>݅nQ.Hr!ʍLѓ6#&RS.; Z4-tdGa]wzmsM '8V͈4X;-LzeF\vS(VR IQ1^-w@Ii#U\xTqBH~Ihqbcb:µr)%mE.k)2CÊlA%nҩhwM" DT_Vc޷$uKm z* OSe6F52ˇ%-H``5QmWŖ5s֞B5JS\:U*sdF[(q)Q~pDdTVn:nAa^UEګ0DX-Pq&DF%E##ddbRNs4-%t h2K*49A &*ٝg\Zs_UnRV-))4 jd|rilF w*<#,MqL֘-iet+̈́qv<O;<[%j'gue⦷qmN (LӜʾVcY]ikLA\].q]1P׃L+g 8aRNVq`&H<{bhpEB}F}ܩZG)In'`חq&YT~?Ƒ[޾쫵f|h1OҳRO2#|.n]ŢsGA"BZBi_֙*u*^TP(OyTRRTDd|H 0Yܚ3ww*Gd䖣i*ώD~I.>]40(W7} y A\{iO}~Y22Kd&G#䓇4E}L#rxʻim1V~\Z=s>N|XAyp#HvJ Vu)L5ޟ\P ǡjX*3&s)"ȆR_ Fl`ݼ>R2w8gz0VqqƝmM:ҍ BҤ'##FF#F`v.K$@D_Qw !V>"/D>$Jvt@ " " " " ",ͷ]mlEIETOA2^CyqYkU6bhv'g~iV+-[AM$/0k#E4EK"eLM>$dYAa lB kX5隦J:I.yi.|[xI<[Z+Xj1=KҐSqZ:V<W! :)w`8#aYrk7FvKc}aC١{Htfr"c (Š"$SgP7ZVIKlKzF"s6ِ9NP8iwIQoh/DEDHtwu~TZ,vS*75c$`  ٴl֫a[j::Ze"q$-JL#3pEGy0K: >_'O)9sI%~E[bYjmBLi{J΂od4FGȳZ@dD摰$8u|qf0ǁ Le Є#Feh~T->]9MEanyJ$""RcD1-qci#bp݉!{F&9 xnXe{PmNsǢ|q LֆR`5qǀWZl2[;$Hծ}lok-LpplNfоbj)*S*dSg0xv<˨?JT5UCЂ ^0UWhV{c(VV%JB(д)*Iˉ0i[߫vQ/-#ڳ%z~&em6+ u|u;}+h+[o=;uGYIKd(ˤhS!-@t;eu2W;=J,ToQ ?Aoom7m\t*Ų˶q ntdxԇO4%2u>]y (ɳQM7 9S4VIE4K#|QLʭAϫUK *5!zWL)ZKBȔ$FGdbH⿠_י*u*^TP(OyT,Bl۹zUy'4h3#/ 9s wV=W^_CZERZ]=R-{%%/)/"5K7llz}vwbeF`=dbZ J*~F-ƫ[_aOgQ=yDv.;S0-Ti;\.b\zlǬtTpc;! Im-)j6%936g]f' ]vVѸ,Ϳ8ԑV^fCH~;}Ky6RTG% 6[3Vcii Ym,(ipsO1Z5lYa4 /FRTU(GğAnΟbDDDDE{Z}mk>\KՉUٱ6Ýȸ>bu}q!FXލ e>.oڥL;aնէӊ5=Iv62<4X80?u7.7w. ^,?6d2w{N앱wj +WơG&-N2gʥʛ3*vRm Y0vZF9\Ug488 k{d}kWj[KfD=tj\JIďS-=<Y.FzZ:We7s6 k\Z̧ wSv]A\R΢@Phݗ6}knIn);D1NԆ'ijrO/9y{$Kq7ҡWWa*+RlujPQ7 [4f};ͥDF+S=ͳEhn )1cI"GZ+}{a= qFu0kTXIȇYU@X>а ϸiΛ_H}BLmݻhQvsatHܢWM>QKmè#KെvZw%Fz[.ͧNCWyDf]!nndKmp˶_^]˯&fxL^L+wSjԪtˤTUb+o!>%ExX5RUkw9 Й*u*^TP(OyT ԞW_TxIxy o6~{=`pćO}$ƔhQ2#IOVj4uAXZ2 `p A0FDn(Jrd$%.o-:)niZ,q - ; b+[RyF?XŷWm1hGy4O<.KA6FE5֖ʐ̔9i4)<O7##VsA^,sS iv[C{޻g73E0mMʹJLBwӦ,~R }}9zWf].D DYu`T\օ^XzTGPR&J><ZgPrۨ.xGbGS|k]fGH\ " " "-z}inE~«Q5nFbJcy+6ԗsjIk'Yo X-qi-#"ZdAЍsVpf|SmdC DzeqsA}_k[kۊ8IJ")-y48릳BwR<pM yT3{=Dгb< !${J5bݣ wZTK%ǟOg6jA-,!ŖR}![O0=3 Cκۺ-WZvCbkL-#k=ʝFv[KS{L( O= L[Y(Z82#"W,V듰4AI$u)]x3^Y=k@p %0;V)7N2eSLeoӞuN&HSc q =Ek) ݧ'1Ruu Ա[ju>sO)C|ЪurƷlCڮغmk扑8n))rHR, R+UkZ9΋wlf6tcZRf+#h.lcS5jڵT7puldKqC7%Q}BӈRn)ץR35;3 N'y*6W޻j~5$JYf)gp X2N;h/9S=<[d,лi04eC\- ZbW-n[kePjJ%3_mF8Zh ̈́YʭȂ^B~ZPBFөg! ))*##JZ ReJ !KwI+R1+ 0c*tmި6V +Ẓ[zDӥ"5k-L{x&YzE@܀i'ꞵb/nZתhs&&tu6Y.J-oTz[p^xʏMG"3nUIѭ\&5: $.o:V V04RriUu=NK96By6fJ]&]*4?>i\ -v-iZ]]\F"PCgU/q6]&Ѓ>w,Ԩ)s׷q\>p}ԮiU->Vj}w},;|)F'R}nύW%[G{ݩaI>5_mv޷]þdjru'f~{OUwڟzvk8~}ԟiU->Vj}w},;|)F'R}nύW%[G{ݩaI>5_mv޷]þdjru'f~{OUwڟzvk8~}ԟiU->Vj}w},;|)F'R}nύW}Ser훢gM'# g=,oܞ:/7`q[}R] Z}=Lk5TKǚ86$K-)JKd(Dddf̌u5tU5AjB$.?hk=A3k\B[\[ee@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D_љ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k&)*,2? "w&]ʪa9%Jw mϭdg /+ 4BBWĚcSr߫Vm:hy$ _w:H?\{^4ruF,w[L~j+n=u-q?d\/:AaJg FW1T-qFڄ, 2= H*r!d">Q'>7onT R4 ?~q%  $fQwԩg׽sXֻ@2flH:ʥl5}1\Pn@luN.|GGcWđoK6èG:W@0#*g<iZ_gFk[I,ˊЖ[NFv9YM^;<} )Scz]/>7W5#p_}ɶv^]1&ziM;tÌ}XWImbj3-V=sثakk %E-l$jW2Hb'4Яb`g{ˈV:#{5EguPo+zIm\{: Iĝq*RD<u^lAw{kε^NOJDd`} *5%g!m%۩#=ץAeac0% ?~z3'19=ٟ ֽظ]{fj🱼GW |Y]o>RQ+k}&F_/Ij2#%GQmM9NzpO1]Cy]lOqc@x:`RUſfJFZ.BKFcM[u=:}[4S[:M?XtJ)̛2|1eRw/L5}Ł4&\zKIZ~po:ϲV{C$4ozrj\eAmt^M"!S2&rRRLG[6YG"əD;Ŭ Y1y I37EM z "ܪQجIT5C̓:J)>&i;8jKU]guJ&2£煙X{ژGMG{&5'4 оaXq*l&! +e[{R.uZ-@,s&:*̜a].mzOZ=bpv66ۍ;3S ԥ(%TԞZ`\ڼi*I& $[Y " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " "/ҙ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k"""""n .к6k^^I>#/*Z F>89\ºժĴ׹߰6j9,ojn*/k8u|KDDDE1hzO1WtvTJKW[ J~n4W1&68 ۹ gV ®AeH1 Su\n#=oQѕU%5(>N5'¾?7M#..yܹܱW)峦9ʸҳ嶏6ÝT&m""58贳-nԻk< \T(˜F# `%ME-3;hM4]JMR Hqd˓dZQg#/EBS8ƊlxͮaHZ}vuZ bc޹Zs±$$MlgōwNdRyg황}jcWBWTzL:^ ܶ[ -MjM7}GJ<-ŨjQ""ɘVcKz3Z\&OQrp;bmner-<9*g8W$U q;~XXKY:Hn܉;DB_mm4Sm6 ύS`mR' T6ffU?E*oS:J`7M)&F^x<`-}:].'2d˺Y^QقdwTp.ZCu螟լ۲u>)u5iK1[ܳ,*mY,b{B0343V@GCWm@t&DrqWVljWvLt9r_$KHC91 ك,k-eGe'95l|}: ufj-.6tgBEڡ-n~g|BX2yd˽hwmA8~3j*D{Vn:y|!!G.-tnB`x+oAxV)Ü4Ǧ {v9 (GIh\-ngo9'A}w{Ü?`/ϟ tTbh^Ս)6#MPiNnZ+W Ůw9]S[ޞota Vꄮ"ˋ9sCFdI&ѯ &dr.qtt=&)~3q.;N&LrJOU; Y2.vV*Y1$d17w*gUF i'-^]ݎ{ Zqh*ST:l$?r֗5JS22?zV7psOz=_wx][I2h{S3Q5hP$]W]lIETOl^C]fT- 7洕ͼXm7洟bX^i߳ਢ&o.O d0ccSA}7kQ\F]蕦uB 5DJгSU; -:JUBy)KRSK o*#cX@Ͼk@[rwoJfGZ9VT7*Gyy :[ Hٲ6m)Q{X> Nc A;g+mx+k{QM0 ۚTSfپjDrnM܊촨(5p3 At GPt=Z6޻ƍ~ 5تْĻ6+󝈖~5=yIFM&<E:7&7pϠ6~CU'ZF lk2Zԓ<2@ Si?J [h7Kk]IMtG{TdG=]wQ4Ń~.r‹ i`r:v;~KrQJiU⛭Qk5]Ė$̙ڍa*KeoZ,.fmzdF;u>.O\Әsy|aԣz}WΙL1*LgҶei[kBFJJ @k4CA Aܥ kNGּf~zG%Q=_G֝f~zAݍ}ii^T=_G֝f~zAݍ}kr[N6M BiRTX224{5'hZKHFgefThsND89AoٝAZ`D ,Ч)[4$\ 2uK:<;;vgcLkO/E2֞V[`xYenǵwdr2R&٩.K#?,= ZsՎ-y?8.?eZ[Vz[GgWwu@@盘ˑ,ȺGb)U4{EPMTw\[C*2#>ⷡ8e|'Ccz3P?fe;b_QC@=zy A]/:込KWΟ9²+_rՖ-@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D_ԙ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""" DddFFX2> _AEoMM݋G-Q3tǓJcsXq4g,}k$gyX+hbosk̪JFfE1# 4QIȓùo h'@6WtrNPdbw.oS+i O6! 't$ˏ"N4L#qZ xSq;[컣exu(Q8Ň{Z*L`<3[wOcLWR]Oq9rZ Fyl׺N:PjJL#-mE2ZAkawR컧x igcŻBNrvK0\ yV@n2:ښuIROFGČXH#0t;&rDDEh7EkI9Sf+~-FV|zV7cB[nk+u*nz][Ԯ)G(uW\h[ңO't-)Va9  ?dgu0)& qvܺ:#E'g݃pڠM UAL'Fs JSJq O\^]liyi.tnf]lAv 0<Ȩض]vH,,ڥ62s nIs(q[%z\R~1N 0r s=2V\G0+Aku[]ǮqK@gѩ*5eqFjY$sݩv[ S삃N'PzV}MFV5D[{ē١GLiى2; 9v= j>U9.]jҫjiKeq. SSFд^ϚfNR7wmh:S9zJDEBt]&5Z{dEޒ/HI,ͯjljn \o|V_cTt}Cb=O 趓Wn!7*5LePIљ5OjRK םZxf\'%i?nW^vYQ]CWؽQM9*ZZ9 XkyhJg)FE3Uԧi{i0;8'6]})Jm.$cIp|e5DO.vcOtb!IgțBMA'E)$X/t Lm.Vbq<+6Өv擽}'[f:}D[ 2i>#q+Q^"Q= tb h3/S-f vBͻ_F{@s>`t.uk*u"a[-eU=Ʃ9͞k%ڒj$9%&x-db/' )ךj2=beZ.Xsh$hJLV Y+si[p@L-ro6ˬ5(ЮY&Dg񌌮h*ocg9C&DA0a}x-g v;C1=~KVսPCZGKtQ5 +2L%6i?Mϵq4ėy-'^RC"AkEw/g]v-CmnF*^SHf.9eJUff-1anqރa{ǾVԪ^;w 8W-9OFCB 4D ںԨ9ʜ\i[oT&J;+k2 p}Hiwsn;y ~%SR{b6̗i |7e2JeF7͔DeWaG4:uxKb\٪Vcj6%pi<(X̽}Vۉ4*.ROF#\$fѢ0\a}Yͫ^9o~YbT)+B A / ZͧZI%/Ee͗HmF=9o.vgNs0־S T*=q.AtmzA#W_^].TybzH-mm5.IX_ZrMόfۧ+w3q{_}o 2lTlio.-VNKX&_5=-4[pCo,Z2#"AwyE۽xKF6Jhq0 3퀺=ίk+>P%5<=+\뾱nL0 9ѴԅGܤB4l*⋰]ґcZo\#R]tS!)l?KSfGҷ$!gᵍA6Oa7U-'3NK]Ӯ٪s*= v2@91CIl9\W̼C4 BFFFFY#k$f`QWaSA2:Yޒ/:込KWʟ9´p+_rՖ-@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D_ՙ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)ٖٵs[<#228<$c.ae}j}?1oa ]Z ERf]eF^&ȼdI/|Dj*nz4,{`=ʌ0W1Trl%PG,~GX3j5^*2!;!X'O.gwou7 1X-rlٸU]wz;I%R_3 `ݝծ{\7'eF~tr jn#W(Ҹ&tw#9çu)?D}'3sYՒFT^׍ppi+cfin:9\pX)G撊DVdsQ:)%<|:D% ,ZZt%(9c;vZ|M$4HsA"'#-.h:ZyV-6#W0cNۆҷZ]y\ @]c F̉>D^9q A9&,Z]Umd5 /Pn{:O{`n C'``r,eR"15 ]T .g]GyW.  [Eۏ,Ieo,% eh "@ DWS&x> .i f7JLik #(8djVy ԠdaRE3H4OCWOo(+x&bkΌn`Qr5%Q_%u{;ݰh.*v`3.4ҹ7L#I(GAם'`kDav5Z0и7U{hXpZm*k1IANSfL̛JT{\3>&.Ws +;9[q;#F# NͨX=pD$WH BӦV k>W Q"qhV<{/WY@O*.P ̆ "ziDf~⹩oiK:-a)cu/FkIFx8=@~Nh)@'3%Ӗ݇4lu=}wkk@$CzWʭ;=fӪ0^ 3hR-Oq9RYyh5+OX[]zp6@ N(96pƚsڼ^ WtP|TbЃJ-P55 _RHJ`u .d\E uJxa,DIsNrsH$<*ᝒ<872N@o' uKǗ N'ZEpOXV}> ۱ɷﳳw-?Jҧ/nӣԷ1Պڭl۱!8*bσܴ+76ー)<slmFƅs ry9,7wOpeN1p)sٔOhY18g8F_"""=KtBiBKBVI3,-*"+ jB75`]q--TLt +[mѪgsg|Li6\DxcȖ %lR[e+I(Q'сWyWgV5$DD7fv[ϸi8Ԏ~O`A]o>vfZ 0r"Xc<ƊFݻhQvsatHܢWM>QYy?RെvZw%Fz[, ܸ+oK̺% *8W,OKdJttՎMdѭU%8Ltֺȯ9(34Ǔq߸BJ+EFih{0]]샲-{WN"bEwDK][J4{32^ƕ*0؛޺6:wcVG 6F80t)ÿXtr-^@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D@D_֙*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\m>IEP fKiu)Y­B.Mŧx$ҷ:'r"ŇK|!NSs& ASv{mdkuHx'T!h+aKnFP,j&jۚ$*_v0Hgj šZqacйց65*):-] %OMI!RBIRHhzL4 ai2Kf vGXt^fYmf&0 Fr-)aH=^&@T"]uzZ58QL򬙬%GFyv 6 2 k񖆽qԪqHfto\Cm1|˩¦J,6U3-!&gZPY 7!JZqe?89ƫ8u&؝8wP'lKysSNmI#@]. mȷ\!)uC$ᑨ]0(l6B tN}"]1u/%$=)AK:AЍT*T @Hط֫\|M(+TUJg8iRYI.B\oyjg&IFG5,9Ai3=Z@V%{%n!M8H'!$(sTG*x\~}wV$Wk% xȋ JRJP$I"DC jhi v1wڦ)et}nӛu׮Za.&=G7$(̩7dԩ%r֎헗x29R'$@jTn;mnmF`¢w9wTG 4G{֓һs=k:szNT2]RKB GP:n|\[wqnjOO#d.}v9. tʥWU͛`QusNSl͐)!'2Q!i22ʋږ4j׳0 o;Z.]JهqdמM icu"0 ,oMTt4t.z Ag1^GBP_j؋RkJ w$)’Wʁ3qMI& 2RO]A -MGXZ 3 CH meu\&" ztؓ]u[q,qWH[/kG=G]͸{m3sCINǒaaf[tZ1TӖLrBCMIuRP9F:; m+CqXCp$F D^-vy5$F7ac33Ų2B̮X/ ՘f].a`8,r@D@DXk`L|EphWڵ*J2:RJ&D7äFIKmIW*2ec =NZ׷s:*] m7v"oYxWmIJ"u&8BS/ >q}+&a;ii`+~[uX&ZhUrE&C/3_@Ntk>]&]*4?󛃰[F|*S*vQ#v Ko'"$¬|8!-nǥufM?3Eoznԑ7e&mÖӮMF>>|.n e)=c"Z>Bי*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\dJ##"22 -krhޖ]ܪcҹ-Li&GG)gֲkw8bor!hb]/ݠU+6XKiu#ø9C"wc G*ToubZwP)rڹ$GH'`>~-Ho#+nZ)Ty0o_x4bZ m`IJ[IބOh\E>.!< U*VN,T .aqیΘӭZ}- #JFEepp:Kt>3L|\;O]/VEk'U)xCvɳVΏWo۔zq=}1&:I}5Y/kӢ(9AbpcNpDCsX B-}G`!25hF}*I/VM {̡ԦirXS-DǶ[r:ɳܯڲ4RC+ܳپ'ڰ-հ9)$夡c찾1!$s"ùȰ"ղԳ9cl\۹Ю۰-6Ԧ([P1)-<2pTl3<2cHZmLR\ԇr1jF$JZ.^f g تȕ:Zw1;q\8V] c6VIp(kRdx2[̹yq;IZvgGk8 +mVljWY4~۩.!*mKI#5ḦY -a0eI H'8eܮD. ۞NșȂ59- .+:bSۣ&KDJ2:Rf$̶PX$%ji2"ʆ;lX{S'xn|a>ͷ*hnQV\V9 Bmm^Hחp۾tRoQri7rP+I7>2-N tgY/D.dS64z Eok\6QD.HҞRK2E L$ϫUoK Ե?)S4[Q CK.6T###𑐨W4q_.(Й*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\ZPsEGʳKN) 5VWIxF]m U>(ӌlkb  -{Ȳ֩Lb&Qi3-6(Q 9-Fke,SIEKMk!f+i9I:FlEn޹elC݀.̸T^U̬ǦƗ镃wCvմѧ, :3֑!IɰAI`ͨxdˇT~>HI>ػV@5X-rlٸU]wz;I%R_3 `ݝծ{\7'eF~tr AL<4IϤΎg8Ԥ>!!gVK}SqQ{^7í!y@D@DY=u6fuknf=,Jehd(R č]zoSeAkANn_[kj6Re+^y% =ꖏB/Ecycfވ_&Z \uf)cfÎCLZkS3  ,h HLb.dT4Wm[GX_"5:*bRG^XVݏA^R'tQCv;-T:T8Ĩ˥%.5(Qf{砉4r+u[&'KkϾdTpN4f 9^ 9+=#oiN8 Ӽ3&+SwX恇2Ztft+E»`V8[J p@ѿ*'g"MZ[i y}$zС+U6Ңb[)ȍM; 5pY83h Tp;q-q1,n]6}aRhy I6fOs0lv6.Ƈ^+.^ $y6rTI)*,O@zSuFO| _:gyҫjxc˲IEnyk^:-U =}2jtHBF!Idb9!mekqmӫZN`-RMeڮܹn&zUS;Ddɕ(l߃l 5kf i#B;^а)w!PZM#9> HUt[J]WohڌS*𯲗EphYg؝0X.'wq:Rcyz;,oEG_՝/iθlʔ"B[ĉ)ABZA!>kX8to&}=h}M8r斴tZh;)bL2q *CTx̅ϊLp>$و׀ѷlca<[QlÿWL[,o: Lnmfj~eǘjJ7_AME%FY,\.UZO- ~0.kr#MgXH98G"TmMݗ*.EZRM6NHI+ENꎧ%.üH%i ,jhhY9s᳼%CQ[Nl:b*;vݫ@ԨS 31N0RDNqfu D1ߍHqmnCJp,uRt^Zhy9; Ų9 UI1ض'웫1T,9S6i2ڏ:#N~u.֑ЌAlX;_S-@JԋI\q-vu7j-XI`ͨk`Qs7ݽ`Zp?![zmBUtڽvK3F|*Y1Sq$XH,3AfyyD ٙһ>Ղ3u5M]kZADڝ)Y58DpӄAxQ T׍s\:J+bz5!VV[̶g͡dINhO6έl(q"GB+}{ak= qFu0" I9+x)ư}а ϸiΛ_HN~?D.+~ۻv$C2^InNɗ>?ͧPGQ_]jy*4~h\ ۛOim͚AR+cgv s42!}Qљ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\W?Ue<kGsڷw~ٿm[GauVyUO&xF/?]Cj55e%Z 6֧V[}[JR)&Y#.$bq>I Z` ܹ UK85)8ZFA_*`עAܕb!7 >I%PTQBRsK2;K՛"Y4Z _.j4mI.p@#F['zcF)pm[TDvy8J[iKZρǂ0ǹ 1R 8^4Ay2.uvmvf? ̼׊(O"¯>v63+:\sCo$"6R\OR|fEjgmN'%t׾]>-)=@[vݪRFHꋡJԨT4=m ?8q+ e]^?"`]$鶢IF-GXv [ =Z_6dtfs˳9@PWa}Yͫ^94vٕ>W$,K48u2>]RϋM|u媵_7%hZ42 mh,zS'TƮVue9Zlx9[z7jǸvzypoWz9Yn~i)XJ\UcS뻪lօliu7`=iĘ1uo5@#6Nf]N*,op\ٔRPn x)K%Ȕqqh3I) .s3a\&C\FMg ZN-B*ou6cs4H8Ů"r=fҥlN;EB p۟vG-Y2i$FK Ųwy|4 <[{ P Ql֞(LvNG o;15)14FNv9G8}H9<=jNe<@!Ѳ 0$ ;Zo8E:a@u}\ vbHu[~3jqT։Hj3+ImjR)5d]n>#l):9]ܓ, 6HӫX`F`@ u]Az>u]Vfv1ULmuBũêT^޷4^MypV Ͷ.o&0YOu-E(' C_5㩲JoozSקU[ : B˸mVL9 ݊\8@dsT}Moh}pN-Y 0p6Y}2).Q\ffX,$+28;s[-f,V\Q^qdZ @kۄdYuJ4myl],H}(%>:g!_lnvBtpsi ԑuW8o(H'"`e5 ZNCTuJ> dnjE.BB(T5(SGBgciiwzAm &_fp)s3 \:E%VKmQEq*uD˖`T5G#f±9kK]îO^\1` .ԓԪW׭o=bRu%rK"Jq.Sui$4WA mô:"{Tp2\0C Ȃg@FTbΕDDDDEVQ$u•RIO"<JzO mI?seG0I{M*Q}r[P _eAn*3PY .m?п{ʀNzT췴#i+*}uQ[-)TxKJu&e{Q%[#%%IpuUPq5Z69 iFJp˂U.;G㉮DH j鱍K@D@D@D@D@D@D@D@D@D@D@D@D@D@D_ҙ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\W?Ue<kGsڷw~ٿm[GauVyUO&xF/?]Cj55e%ZNASeӢ:P(ѣ0qמv) $JR\o sV$U+Gybji[Ty"IQZ3 ӫ%KÕz K$e7^Ftfe i9ݘy9gӬ7`,x A'9jD6_=%2[Fܫ"+KKH=JRx,w -7݌4tmpE}L#ryQʻiKbZsP ejLI{~J 7:DvJVU)Q}ҹG%FtUT)ĒLwTӈIIdf.^4h7,`&N Q+?]q6rL›݆̻ pBm&T\h-8A/IGUCp Y2kkK[" ʁ|Ju(!^<]$`mwc{cR$&о aռMS*Rbgm:bSmZ042pXkҦvq"WRk,֝meԛGyCܞFq 'mIB5U{(wУMńbd ZxRY se,=:sq dJvRmi6JWcբ2, FC"yri -M.]~2ۊhCF,iB3ʋ:siB,k~dvS%dOA!C)\;I362*Xv Pm#OKlz*Û. ?9 LwdR-GöKʺ:K "Xָ 11TpqZGËZsPFE1ׅ[d kwyݫY*횺IZOPdE 'Xs>* C Q2/ֈU.<׃zFmEUrRbE 1cG&E9.>g\֌>t+UYk` x]U 0C`Oi։o* L0i|YaF_+SҤDOMB^ B>뷗og01gT+ےmz cvFZ|wu|J/r^O/cw#::ICku]{*0s8_)+ md /fۆ{Yr<$[iEx7˾J|cc{,p{8Fms<[MfvgƸl9\m1RػVZ:aOBV5]v-l -֗҄UkO!s@߬@+6ڗ5: /7DaQU/_R*T#[֜;!ṆuI#,JK᷅6zꍀ7-[-#MQ/K$pn4R̢ef|=S+5 ysu[&5-n6f!T2BkK$$d*,U \W " " " " " " " " " "/ә*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\W?Ue<kGsڷw~ٿm[GauVyUO&xF/?]Cj55e%Z]u7κׯ>6Z_&T,Ny> m]1 rN tze&60 y8,+/K=>É _ ٫T QƤX7vsUd3vCkr%"m%7i֔ H) pJK *nz4.ܻ;^X{j`wY+VER ˰Z7H|ZU5ĩ )ޟB-K|ן.gwou7U`Yh uZFAg>Դ$M">4̴ʸ]vWx\΂S)ۈ.e)p\ȫ9,Ǵǣj*%ܭĻ"ٱ"२~ս"q+҉<:A5[:tٸɏDYteL+ҵT! kcE vеMƸ~p*DY_kVUNr@isQ 6ܒMJk?s[YgD~ +gsT>Æ86-$w٬ʹʲ-8T㗿ͱ2#'#43ΰ6ճ5-Yl'6*ܼ#Tݰڳ議.ߝUѮ^ަѺ.8<٢Krx+qkzpŨ V\+=IVkD49vqmPY)*[*Z}hS%*O뼎3]Ej$_pg>)⌳0ΰ찪.40FNRaN9I[N ҳ ca0 Fzx+ _TµWi肣TJM\ ͨsd^!]iyĆ' 'y؝e~*8{0sui\j⚖4WgXZ XVW.LlD7X?b{CGix9-2 zBsZg)z˲n\;2J*S44Ȉ J IѦ,BXb"KVNm\m.~Q R"jŝv+,fݦ.p&)au:+$P㍩^$;=sjV77l5^O3q/%Aw5*S\KP΢@Om\ץֵӻU}~>59-e5cTc7;g.2VtN# rHfɅI-tȨѳ՜Ofܦs[S#yfsXϲ֎6g:\ta\_]~V׺Q~v~*[Qو edje.6DfGWItk׳xg=擼H#ByA6046ph [mY:cձQ-ŧ2JLZGAqIIZpJEJ/jRoKK-8&D p @I#ycVt8Lv9DADGUn)=I/.W +%WDDDE.r NzHE[;R*Rluj![ېefylIQflZonL+$t!ݷзTiS QR" {N2귏py%I8rdULڝOzeR֪]+XsV)r%>aO*FȦydx'u7vC(= m69Fc@k*d}յohHmיiDlQL˨oM Z)ex#RlW*[1d2Aiq',)U'C{ڭ#sbZ]#N>=YSTОU 8{u3K[NHmJ|c&LA 8gAqOm FZTi0Hϐ7U4yMtYZoK)l6Ų/2<`[E>*`ЀG&d]ܓuK3Z sW5آN0VF 46p.q]쥗߬ҽW">4|k*o/NJƿ=_>4|k*o/_2-,ˎg/ҿx51(gJWIpgbjA{JRf*2sPFȆt%9ec =NZ hp ݖzl(fWvۜK",)Ro~s%2sҰ{Ϲ}lh,?]ueƅQ.$Rd9X2I#?nEt TAHֺ El£C9; hmͱjɢ2j7jPԶ~R!"N|*Ân?zW_^]ok>tʣꩃ>A*V&IvRk>9m:NTj#!)g͟bX|8!p-!e/ՙ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\W?Ue<kGsڷw~ٿmZx] " " " " " " " " " " ".s{h!Dڧ]0t.QZ~aaЫ!ZKHE+'NͮYDβD#L'2~ vrOi #ZoQbn֦nlNU^L5TL;u+ZۧLD:ʈX1nle[PiaW;4U-N[82Rx8)(2%` ^++T7Ni״u%]^%q3*O"47pѾ>%I qoVm_\;+^Y=!j7w lZYic^>պ  ,MBѭ.NX7KMu2w$Ɋӎ9ȭeJ3VE"!B:`$ fGһ.y`CiI-,w[TgV ejNA fg`Xǰ@˖GI$Ho!au~ ";%v=W+E*޾iVT-rh.ZXU2[)F|'<k.UWdq4T 8\m\q[SNBв4*IFEepp:OeV*VayN!Fy. $,t ;M .sj㳑u Y/CAi&;B`…l[Da򤸷)I}DLbDƃhSRpg.t[esEPHMڒ&$1$H+AZU*@FN!vf\)&PvDڒe)hf=q޳XQ̞QYgn-'!9JU̴CO`wO80hX8N$ArTp75g4Vn%OR13"W4t4jZK RH5(Ⱥxk =#Oi!\7Rtb7g߄ne*s e239I9#9#Bv6okW5-/7I Gjcr_:#VwMAzW,1qχ0_^J2/ǎ%1t,pO\J["r_Nmp֣F|8c0*Aי*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|u)Kou1tS ujzAwr%2k""""""""""""""U{QWLs}nl"JoRǾ.uwtKw`WK<T)8k\W?Ue<kGsڷw~ٿmZx] " ",յ.;ZM~>F-^%),$$jQjSժCZ$רjNArkK hةƉ$N3' %Lu448pvVA-t cE3=dmM*mjw0zh]]BMjg9qzScKycf)RhUӻW".Ea.qׅWnv?؛멕ם-齫uL?O+8,9CwU`ˮ"E Ã]3;sv Y]GJZqʤfsΉyC&G]k|OXŎ`Z[Yu " " " " "/$jL.-FXS2[KZ-#h$ҷz)rM 'iyDe6Ԙ57jkedkuHx'ҹ-rl)mIrӽ4v8IG􈯻t$zGv̭TXV9<`1[zW&ƚE\KAY2mLrxGDWݏ ~J MhW#L޶@\Pǧ7J峫f<)0LsR鶢IFB#nQ2]vns֦v͙!sVCA^ҏ>f*H3ʺ\L t^V¨)h틉%|"o\:bKq/|&~Dh}mWUȾÉ' EW70}qC#m7O.1;5UfC0EW4JV*-!rdF 1p֞q_dC@D@D@D@D@D@D@D@D@D@D@D@D_Й*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|65#O_EZ= 0X2ln\ѽ'8xYFZE.%|q8#AȮwuVF4]%ݎS8q8Aԥ[Km~Boj~]}Ox]!kVdnT_~SSKm~B~S}I{Z~o/տy)y6?!|~my۾U=?b7j߼R{S`yԮaHCir #%%')I#A/qIe9;gN< ]S[_x zbG5 69`=^;Y{r]WW.rb宏 Y@8OAoڱRgM:ftD+;U=`n]VA eO/:!}m=tdgjEBN*d}ݐ#<&3 HΘiSTnF{VfO§29zzǵE aˆrUO/B&LWpQVK"4kub8ᖛ}a/V[X7[xcPtx!+z[6F^b0>چXd:EX7K`կcA2]nzyiMVŵI(ՍT8lVɚ2| ui뾯{}EZ;^uZjWG8z5Q[dJ##"22 (iJon͸ڍN`Ȁ0lKt ׾8VL91Ud\eZLsU8kG~!F:h c`92&KW=ڔ_2㖾NP6開c+B2VղzupvqȎR70iI![#3%WneVAl@Z'98.˲w|n ӧYo'l)+1mV8qii$Lf~Y6K Gy|Rqc3*qn `;ƒ-%>2w5Э9< 8bF0w2¹wZaU3j0~Tߘk1 X`5ߨtiݥuu*Ue*ʾˍ&H_"N-*2R䷓,pz7.M\ /[avewwO@+nE6v::HCdH4+\L9+/t\7 nhu ̈[l I)#5(D^1_jFHJJ<$B}2Kn[)"<(ew" " " " " " " " " " " "/љ*u*^TP(OyT ԞW_TxIxy o6~{=`d6b|,{ꏛ}lWwOTvt#]ݿyBQӊU{h^ VXۃȨ?Qxn=wx'mz?FէQY";:Y\͜ի=!q IiI>';pBk2B-Z,K2a8?hpIYo|%Zs+3L0כ΀)nv6jըCTQk .Juz]Jm 'qoŽ隔pCmɆԣ2Nvuxݷ 2qkZq<ɍvEZ ̯𧻓* cwIĘ$Fg}읝mi:zv!UAɲm'&fjZt \u2hZ4hf v\*eɭɌ Frc3BĤ,ayKO*|&W"CiiqBc5Ɍ. TN[km۪3[ Ίy- lO$ȷyH xG~ Nad y:szjm S-^6yyL:dkT+λ'(x=ujpKpz6|R^6:HRV5H`փWTDA5c6z¿=;u[+J.s>ܲ.M˲VɱѴ:=,!ʷҤSQWsk28ij<:(UkSgrή>^|)%K)厫G uL@$'vmGKr%Y2LRTnrMm3"VM&%U-4̜'];M;Gz޼8-2о$@s\ DwF쁲UXbHYEsߙ)ę<(6ySKf{I$fk$n FC<6Cf3Jբl٪Ԧ ѕO0 o{^*~8% X֌{ i8L.4~uEri 5;U'&p[9LöԔSxNTR嵩5 A mٞK6;޶b AI*z&,tMf90-l@b@mNNKk8ѹ&ʾ"jNZb14:ҥ> 39wi+ACVOQuGHB DE]P=aTtOjMʪPlo&$c馡I<7qQ;G\/pV{Fs {3^ޟwrAxD18ha{gv}Ư*/Q-Zw(ɷQ:a"vj4M^9$dHi"ue}- Q%]qmFxi2Sؘ]PFA>g27k&fNrM++.꠱*FjrޮEm4溒-Tɤ̽8f|2eM I>qй]j>Xgٜ)<%6~ҭ{^"pW$&,1SΫ]DDFjQHFdDf;jeB։$άiqJnd՜Ɖ$2rdT{nޤNҩ!&|2ּgjwd 'D5Jp p&aDUw0j.Ej~Owp?'S#N-iBLOR\s)Wȡb "4s۩ӤNm媫rԩEƣ iA CUFѦ.l-y\{6ͼv,*s3Q;I5̌;gRd:f;V]vK~ w8n=/b @ܛ yG-;ڥIY,jj8Kk2Qb# ]vx+U?s<;\mA\r.adƟ,IK?"-K ]vwi* GU A\zo&dm^<AVCwO-J !0J4Iq*B&Y/ `u#0UF Gi}FÐ#ejUKޥ?/INE:sI%5LvBgN(K&P.pBBV#kX-vSLlsSc sx踠fE)Xmri.@-u[XUNqdٚI_eV;w &I8w–2d6-CH9v )qtrÖS{Aɭtv 딎m{QgCSJ5pro!&TMB F_HlڑxHunoKZq;vNrw>)"XcLcҫ66EcKsPvu9T_U{yS:{Ww_?jUS@D@D@D_}t;J[|=FĨ0DgK?$RuQ|fBwpzl4F!8QZOdW?Ϝ**u'{+rlL(C8gUY۩J#%)1FfKpFй;R3å1[U?&ڻ(Xs Lbɺ Vs> SZ4 e19zC%4Q'P]Xr4P+/6T"2a`nh9WS8H#h0zmrՀ.ؠSmcDDta$4|kCB\NI=e|ktZmU+u.%+ q*BKBҤFG%PXʳmɳVEjjߙ* _AEM]bQHx(Ucwp}6VIvp^@8]-.A-qOM(5ŮPɗ M_w;?\{TruFuVo.ٺ)IJ]B#b;%vW+E*o_x5sB7& U[3)J\E) ١InkU&F{YTڔNTg|eG.2#hղTXPF{j V{n.]M:k=k\tl%Pz.UEHDu)֛/ I|#p8GkI=%F}LsX^vqZOI+;lߧ8uZ!1"%ڊ[Q(&;4=Nh[en@;y5caraykӺ-ma:r&5SX4D.K iF.c.՘,x u%FDYol`jZͦ$~渭7^&sFtWOi n}\ΙA!q(dVGЧ2#qx,)IprvQۛntj~scA= mWg|A{LRv{DE􆯫K5CEڭ=}"4&u'2wzOw-w5JXmxpHN*&y6[z/O߁WY&G#uW%#,bb-~wR~ơmOdިn~Ňث}/߿ӌ]GO?ܟ_Дذqoq I|Gj+u}ndG8 J" qS︽c~7Q_tV/|g抎=Ay g)\hS&q\>j"#Zڳ?!<4K>|=g='+G!KӋç`zBR2u/QiTPv!mc՟,qVtc+=2r4O0#*ǥX^Z"E1BZ]#{FS]fZf܍R3Q⒔3&P?G^^'^Uw{[zʹQ2`g m׹Cްtm.$%bBV>uHna܁4i%2G2[č*$7vVY99w!GVY/8OZ崋E,Ǝa0܇h9DPl=sKp˴ęO[Sbg%%4F I#K#.,] 8$Zn,wa['cs{-v&TdR Ď}&_zC]7?"B@PVꟾ"}&_z>v ȟd*oP][~Fv}cp]7?"}Aun'kjw`B@OպȾ sm}58Y˶Di5ZcϘHCm:KK3<$ZL8wY>nrKDoڏzCw^$32j7G 읐 [Uf6R^D%"Bo7.z5ԃ"RJ FF[o[Yd9|#k@0y fXO 8y=FwanZ5I,ԵWuYѳrTg5 7,|ㄈ90V b3gg-ɲ&W"Q[]ne)"bYz4,{`9ʌdbZ JjyWm }.5b*i4"Ժ=yr]vwzajFSx?1X-q쭭Eju2ϗHjNqhԇb+H<ou{חŝ[ͿZQRJ*IRIS➢kGJՙ*u*^TP(OyT]tV{թS!'ty}X3#xZ0<;q59 eTk+2B/Gy[6n$Ҵ-'%I<`ֵcÀsL$#z%r@D@D@D@D@D@D@DS?~⭊>jue%^תZY20uFIK͙gZ7S˷pMmvpK]̃Ѹw:ix[}\{+:eis.ւK]Zu;XDJIq##\ Zvٕu_j4P֞u5ԤLD`JucGIm)iqRYĹ]n{yUl.qDērZ5:]*4D:U VEdX.]^YCK@=9!+$Q>]*^zG]nȺY.XS>:^" " " " " " " " " " " "*m \s~;py5b֏ n~/Gڴ+ @D@D@DYZCiS'9[ɹ>UǮ.2#𺯪̋=԰&Ԥ9%(8nҺ)""J7x0-姤Hž*svroZba10 XDDE"M 5ˮ5ks OhOIgAeqdL'Lʣ)ϳձĈbժ˰Y'(:!R!es'iѷɳٱ4*=)$˳ڊ;v֦Ӳ21%?*X(3̲>:/;<* XݤDDE-J]oZ۱И>^rx/:#>vg.9kz8L%yZי*u*^TP(OyTV-˞B4lK5˨??>>%U]\L\\WZY*Rqkd`YjRQ2c:ےcɥ kyqEӼٷ_tڙ@1有 +][븻զ-/a tm%'.x_ShTI*$̉Iˆ%YAʱ|Z5}-tݿ̧j~NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5>NߓVO)ɱ|Z5cjruۦe?Sd 5dlũ[i6'Z}n߉[S5d6RXf$]7է@`);,nАe>&eƵㅣ.ѻ!w5FG;0܇T>$?쁥[?޹ﲵ䞸<2?+2kQWiל,vFcm,;Op뽪Ci"ro9:CRh, {zBtA[K|+i{KBDJ+ eLtiN$(3jOnnJt1 "r#NPH1S^_kT:[["L}R:aJO>'U,QhxcƐݲZUZ\_d 5d*l_o?cjrunVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oO;C~MY?|&j|}֟nVO7Փo`}l_oڜi~%oOՙY}KKTh46ICQ֔%FK(Ԭ.2o†\O6\.Ho{Y'xXѸyٖ%'j-`6k?MP7eNN,ڮ3X6ʿu1RҕWvGR3_ 8߶U4S/M+|ƬރԱidmeK9tӳG :t|56nGݾw泰TRgleдݓQv|OU'ND*I iAP!$!%.&fRwVՁ}gҼ(E{ׁ Z3L$o1fU8Й*u*^TP(OyTљ*u*^TP(OyTҙ*u*^TP(OyTә*u*^TP(OyTԙ*u*^TP(OyT՝I:K[IoIR0F3l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHD2R>l1'; IĄN)~+#q!_HĜHE֟ER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ןER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ПER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""џER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ҟER""""""""՝oO+̤:]7w5wOFEk=1~1%AxdN31Ʊ a'/1HE^˓gMD_kb1+//סG7|WKFiJvsRaW(>PoedY#JdFG"5ZN.!\(WmVobai-9_\SUDDDDDDDDDDEj f*Zեu6)!g(ρz6 {@_@5sHjU*T aS F[kwݧPJ!rt'K2pHO3Ǥi\$9d+}G FFsʤ^jT^E؆99e uJz" " " " " " "-}ZN-+%[%++u$1d8\L4CZ^`;۾UAMm'p޹Ƈ:qe=}rˏħT$i5'xooO=Ҳ3CI2ՎTƛdNWUfMN4&$eܯ@D@D@D@D@D@D@D@D@D@DZV{GOP+4ę0܅.1ѥ3"#rKG!ZD7=w@˜MejWjl̓9 wۤ}d'GӃ,DzBFVmWSZ6>Z%nEfB^"e)rOJ =ѲԜ2$4 B[PȲ+gڍ&In]l +PKduGcsI7XSnNnFZXRY3xH)Ӥ<;JPUҭS Was3i_]DMmQ ?4LsrJ֣֢8cKRcp8#.@JeDDdFS(ӥTdZ")""""Ө9 VJ*5r[dy2&dÎOǨ{W 70Fa@\j4@#s,M A'.pWcQmyhqeǨ(١ 3't󕟇 86LoAڝ[(ȁ0;U;=gSlu nJ.e-K[~RM?5fu'a<+ Qtwm&U-N_0!stQm_N829rk sQχûMk.Zu^Ҩ\gS1ӜZ\S \.YD{3x8 c7LOr]mqy"Џh+Ij߬CmʪӣKy-i[%j$"ʸdE*`ѮpDXզםH-:""ӟER"""""""Eoe؝.uO<'y=~Oq#lӃ%޳G߄qz"gv xła;[h%iQCMT~gC&7,r[8FfsL""y&cO\_{3{^a:ȈŞȿV%醕GiV+IRX}GLj6ێdodOxÌ{xDZȊ`$A(}AIy{[''-Cv{07ϑ^・${8d'o&?tAY4slȳ_Ĭq24]*:ɧ 5lUwăLLg0ǥz;%2mAr#rb2MD Iɗ2>8*v8$ۈ:vzwuj N:Aۖ!Y/Kj;ϘZj=FLӸSI-W&dFpINyӲan7tIV^ƺo1blFtIn'nղX׬+SR䘕$8ike p ,+,sߌLkCs:e91v{(ggvx:9]k֡WcZeHy|.ʒMF+- (3Tge.f7FY#M9ۭ&j0sN}墸йY銶sٜf$9,ټ5v۴@z9%єS""K -\8LJ6ҨKFD5hivtzm1@xiӟ:b['Ss;1ƎrWכuM_\46A(l̶Ӄ={s:xÐfI߰r0%ۭK73"2Rse!^`7&$h=Z]5BE#Ij"Ph<9HDDسV8M!Iv2'CGN;Uhrf:TϱK[I#ΉϤzV͠@nZ1Qiȩلf3JHJy䨱@sƺđsKjl=9YmwEm.w 4gv6%͵dk3OKhQi,KDD~ז2آS^0˚7k`=i[&*&۶CDcKeQhukAׂ=# ~Ű兮'\}2cnV{KR9͍3p:dr9Z7HWs{֓D09$k =ߴMMA:dzY%dҷV6r,ˆO$T9?p;IyREjY(O]YsMȐO3# g#huOJhWW33(ڐ=&n1 "Qq"lkM2Óv ͏Sl^PTY6iH<D+Clt)4df@:}\U(w~1BBAeIn w6vҢ#FRNem%`Z&2@nD܃ Fpg&IM#oy^-\ |eq<myʶ5| Ia&sdI7>m}~{6mmǗ)m7LCY.$ȔFx"{bQJ4hs5sZRkg?tjD _LdTkuMԸ1NIJtR)t%%h(_%8N)]?j<6FsDu+e69.Y0Ҿp~hkA0DfFB떳HUBA!ZUWuonTz:-%D]q, $gA2yޘPl 9@e ugtNFTحרN6a&>IG(<3k4="'ktwFDe+e7cطJ+bK_ʭҫCK6s̲e2dJ}&iRJKddg-2,dr ig~쵍tx[EX5z@S9rߕXZL+L9hZ]5M iZ8nMI[%c^l&s箝wFRL9*O؋%ٝsHv}Kkr^ 5iOrS[s&KKBi=p TqUK_g\C 5s]ZsrnA, gFDAڹpn69>0b_kҲ}=b6^w9~^Q_W=shË{:=iZf_^zzxZD5ojFۣΊĘ ?41o M&Ï9yFEj-/ɦcdrev+f̝L-㮷e~ͱXurܓO}-ip[!/D~$'خuLR{U2pljr6:x\[u=R9v"f O#m!XZdM ,afDN7o -Uժa~b[ɩ3.wFD6[NZJ\.dFD8ћNo Nt8ԑ2E:ϳ4,球#vyfwiS8IDe4~CUn0-2)HPԚ {NDQ.qڏR96ZY)y,pEK5̻ Aƽ3 #X=43eRt Rtݳj]U5M3Ldu|ݥ%j$-$ɤ$~>>k19ز ~tv!4.Ųr;0xr~[ 3~=px1Zϫu=?gZw/ꛩm~'Qq\[uY8:<9u_J_q?H?qqm[=jKUjÒډ $ۭlJL.g'- O:z<گ;{VQo6{@I1H޶[v}'q'JϧJ2<H}9"=ǃ(Qr9$T Dj 3×8QpY>tbGP +\VͿQFnW!: OLq)Q:RiQV $eaԳVuHq".GnXEb<-˴N~QcwEmn2a$KI7})&$ uHj;dS0C\1e,i$s-q"H 2Ffve=;.+! 9<-WV\1UYδƙri&[BK.;#|8b3{w7ѽU+tΥ KfH6p^XFj+FG1$mW>)е波3˳=q$Z֭᭳ϏM⻷D]Dz"<6Yp7NnIM=ąNy?\ʻ}YKӾ^} b}ND'S-ǕהDȒS}d>׶%0SٴڹưHϺ£Vf2w^5#Ƣ9'<ϱ}c׊ c!!-Km9Ä[hI3-#3I\1Ì+\Ɂ9ze\-@FؒN:v eJ|}c )KQjtkzѧ3pTyE"6_&^$ERwHҵK)q< oKgxݢW4HH ;duFew;9gB}+j] w?ҧc_ꅾxJHZH{Z z>S&=H ڊ1ǏEPw˜#iVꖒXOyƐD|]*4h1Il'Vu'r՞Gt9V#W"E#:wǯOb^Dx-TS] L 2"H뙅E-:Zn]szVim\v:)xҖ ҌEw)DX kU0fִ^prѫe0 q&y hmc]ZjE]& \hDYu4$q.V*z~pGVJ^TÀdzNФ2է$| @˰JEb͠JmJ_>=q>23S0Ⱦ#8#*g?1?L}&te}m6 H˔Dh\K]@3ӻ;5u{c$i:~֪oZQ4#m }Ie|Eӟ[GtyU1z$؛%$gF[۵l85=ԚqZn[AB$CK KxGm7źNC=B Q92vZo;=3<@aٮDvV$E:ݬPht(ȯT=$MFdԤ%D4)Fc'<}QllI9aPxHHIӝ@>9cQ$ κlSew5$81@m뾣7tk_R"-*Y ǕQn`ڒIY7O)=2Q\wF(6e[6u3Ii;r}^LLl[c[^ s̚F(ҬdXG u#cbO); xګq,Ԓ@ݔOX#;}t{8FIZ%͵dk3OKhQi,KDڌD~ז2حת13C6f:OD{Vi~tY*Z;qjUT-2!q-"JԥF}"cihwLuFK!(\[XeG5@q K][kT 0M)-)x|G"6HBv5s=;6/"O&$T6\wjIhƎPiBog23ILKbZ]CNrX˲"g4K\+wqR筇dD[N,ȋ`v,VBgXZR#ɘB̰fKȌ̏&fNK" HIANܭֱglIz3QVTW0fCi.MVV]կP2Z47.42onpwQڔav  04ȎYfQ`G1"dAЃU{WuԊpL~iɱ";U־&w5x)2&:AaNÞ'.v K#K|;YL/1;}GΆٟkv.W4jw<Ÿn [cLffV 0"haSnTedİbE KUF7cI tRUmsη%snⷷ7ϵ!p[4Lʰ^CjΩ}+}k#jDƠ `]CEBbݒkФFPxɚV |=8<."=9{s~{;iEGYz2VVX 0Йɴ=%?')X>-K-zZrU/ &tIu*j!]UEmaUrc\0Ts,} I}Ayv\S*EP2O!lI=٬1g`SW+uWVaU%U$"҄ɥJɑ p&14y5AYxf`pp+4;k|"Y ,w@+jq1o}Ķq7%793Zz:td7իӓIZg!$yAn*-N XvG©S[=`-; J?!.wF}z=g#<6VKU#BJ ,Zpj<CHwg- xk@Y~iaI?!#ڦ>>+ϴdzܗdK勅ķ;bpƷڒ<8ԔF ,Sp煑A;0gDDn m=.%DjRu%)XROQpI>'cϹe6$ݚ8B8+\Ĵa?X[j9TZrn67'q"RYkHKH?WPi>O+gi;s,1;&AB i19 pNyYxDFĚGZhsVsT; fE2t+ׅB>) H]SzZT}ugVǵoQmWeFֹ/̷dzһ):+W+B*ۤ᜞l96ԅp±ݚ7շԪƒ0'0uՠ5=!2N#$5(D1XyU`c*E/JٲⱫ..>EFʓ})Ƭ?ᾱ܎)Ծ$Iǡ-"xwzs_Pj^]ʺ\5c$qrē͚›fy1erv̱i)u$4FEN''p:TקсzJ̸V)K BZߒ9ټ&^mݝ5DŽHv]%{_n@Szjybpo1X6Fm £+r+t2IV7]4LK\\PM3Vxs6 \Gb\ H3ލ`2#Ⱥ,{ƟUGmn:=QS(#^L"tg>٦GiwNvy]k393RʻڴڦPiy-"t'yi4(ffFELjiF xDDrRZkyCP#fڕ6[E:9`˯BhuVLn$U8Qrlm#KxޖͶنҒUԫ<xPZ*7d ˜˪? ә 1zj9Ru:tatH2rhZŢ&Dx*Y$)*3IkŹ#%BimL'a]}}b+jrzh6Q䑭)M$j.=H[hF;RWx4g"arߖ|<=d{5woվgw6>S5zoEF-U{ZohW~J'Y&^|g f Fsrow_Xa8R":&~!F=?:Ixq1FKѻQ:} Ĺ,dkK m頸﬋=29Vq+͡t@<lBpeᶌϑi׍LZ&ԬzNRiJv7Y.'.֞F!Y;XCC;-vg`]k{(T!'M5YPju ڳ2[3Tɏ%Dj箬EےXn"WE}R܂QaѨoUq[RuFnt&svjU,.0ds$2XK)v"k֛տty]p$$xԸ8K8ʒ,sxœr1p@H9F`{`cP7mJ]쀜%$O!M&;HuEe)EtF\O7ř̴Nbr sU[ȑg+#Բ^zlyiWV.biuUe(#H[ImŰfB,'&E$])M7fNBF]VZDTn;8^0f"9[K..uR%*|uԔu\#qnV)_Tx#~ mHk0;˺r;vufAFKS@J2UXi)j8I/y#UO0O(_*'ThI)٢F򛪺Wt"}ʛ#"\{\~8i7噴iCq3|#ҧSc{ @@'<]e6V۷HH8+uqqĖq%HY822Ás٘p@H9F`8s$7mJ@N'W VtHP:Tv2֔H#.'KZ[QH'19tŪ[`LdH3Y/[=L<+t_6%&Ui \[Se7$D[Ĝ RjhAaݓʥ9%v>8+Z3O$˦y=vK]js6'aW}l:4"d{V)PZod)& L$q:oBSZ TxY RJl'\M#"β5 ګޅwo lMf;$%{5C5M5 IY?,fN4 ZY}R{yydO$|S|1[n6mE?>ilwf+0G,Cн߂vGx <~@j)ڗDؤ^&;)<Ň4YmM&8rlcl+驢YKIBsZi=!iP?Nw_{쎥˂:zVhSiW~6O"}% eTnRi2"2`pÞۚ`a{cHOzFFYd`H(oztv949? gc;pH8a03*kq I:<>5WEY 1q|XK+ ,+wPi=i#Ii\i,"Du`*.%FFG.18dGZyBTgaF[%E9;ɾ({|Ӓnnpr?19'6r8hY[;T{VtѵmjխMnAqFv5JsIy.M}ԒIgN fft-U`x >BzRVagv1gzw hԭSqh%[U>~,cȀ.'ҴI`?q!U{>hzAK`':wjsI~^6LIB%4MEԣH̏j0;#pcd6 5ՖZ>S5M/SU>2gKk,Yi#\ *`I3ϑ]){D=cm`lkY(߹jUGSͥ8^İJpE5,ȏH`"'lmzN0f"Nxߕ-Cm'o{@{Ֆ~߭H<")%m>c}U5|)4Ó"Qqtt} ujrkg랛/}V0-voXE*"J_OH^ SZ`'p޵DzRzo0g1g=GʰOj\)Z>޿_-yӫgf஖NԦ0Ѷ`gdVΖR[FZK[p(p%8f7dG"2iLFcfo ̍YrP`ɭzWD=kk=BL>Gs8{|ctD$1Zkt\?7ϸFRgXԬ~itsIf 﨡 9Pw:7m/_5Xg2Y)q4{VϥZոp1ebIŲ{#^ڌ3漗7Sy~ cÑ"#BLE`ߎg""7w)F'p޷h ش&k5qf=nVq V>&h=VYrO!Bgmlα;2]K(7qsXUe* 9z%W"!IW6|RgՃG-:_ؼv\>Obk=Jdk2z]i^ſݱ8ZOKF[J $D~?!79ppAc$մG"zA(/k$oinUVͭpgY37-aW+5HW4.ۍSoZS4VsL*{[]r_/ 4K a ΀ oYhDzF?N2|Ϝ{{<|X1]_Zk5 CEpoqqbKKva[-oBb,j ([Kfdf'x&j/pF*ګqMQ$:Hr\,aNēRH1A**)MC#䎜ssKDYw>͵9G݃ !<+~'|jK M:?Oߚdsd!$dI"Jr{Ifft-Uf909<M9N7Nacc jg¯(Woesji9];sϵ+ҵiƭ W .2? #|3ʮ7M0fg@F7:}n@Yy9&ʳt!4COM11hpwCmDDLkV-n><{T[Ŝ❑nUz9֏t4A#ɠr-X1)P4/VRGEFg֣:zB;l]Q[O~Q*mr&NZhIA$ φLX^MJe .$a9xԵ;hke^-vnMqLagě#q||]ϯZ^ǙM:jkt fןbۛ-Q58u.d5%FDBRQ-)Y&df8->Pt;" #Y=巄ƴ49<س=MzTS\f[RHiMƷ=.Ģ጑BHЙ#w/JZ NCɬre `cbem8`7UTRR6ɂG(n$f$טyNQ h&r(zlj~ʟ<rc[f^9?yoY[ۻ=_zI+'9#kcSUkESR"c)ܳ,"š.n6{*v]>f Ñqs1^"u+^ fjٝi?Ab+qˢ7SXc ftiz:pŬ=oե)Id񠒔72V`̕xsK!3N}j+A9"y9w.Wm+p˞] ӭY \QbqDwbv12 q,0Ffs1zfU8ɞ#3#RZd[rܰ4rF 14GTNV }#;K_jvm>O\l*ӑ@/aGۊ].> *Ir5>"%g@߮_EuAqЃm;BxﴴiSz巑+Pc-ron|8V!b{ H{u~9d!x v3roYnOu99+9#<[˷:JS)ӾySo_q86ƓWރL=w7)p/}3OsT|mp.}s7 o;"˽D_x ba`Fغ̹D)<EJJgx|"zc0DwtbdPfNS+\,$;`S6KԪ}X[/\Oh ~CmGh}kѰ+.8B@!ݫ:i=tji/"\J٥e'IɩGdFym8,fXr 6N vZv4TyFgnېV]VĜna>u4ҜOSs e>2Id.5ȣHSnX :HvumWl$ct(;ÄxtBԯZKT4JukRX TjheÆ<#d*V"CNH|0&L!ZΗm)HryIO3"-_ſ$=VﱟϷخvTpm 'VC+sEhܶ 91S^"2QyT|s(j9'Ӓ22!+;;O\FcjYq̙g3EFR R\TVn/5mT$TI)9 ̸ -DNc,:wh@#-'='?@Uwp0q#Ҳ.ck닲r~cͱʸ˛KlHӍ\38DG/n'f+f: ܼ׮͖>ER=Zd)ǛeN(k&MMs$K"xbPi#M`?\+jG#9ʯ` Z 8 ?WͳeU}vuʫ;JԸ1ʴZyCSMIt&6[̇MB H:Fu,4@'2NFuv|u]־y~_wm S5gnGŻh1rxY=;\gQ+-Y 3!f5{Vԋ U^o>3ѪSw+͹YiYK9t vO"05׾'ڢYl|Kd 򯷍5MHt-.$i$dDyRII278AW8ءA6u1;H@Y!&Rѓ>d1/쟄ĺբ<,^+mk2f_ h'|Ǣ9Iq")'Z5NQAtqN qc0@!mQ<KH&&IDk&Hu7K ζ6'RƬ;ZGňhRCiSIVw>Eƙ$m2z h*4&:@ |0&L!ZΗm)HryIO3"-_ſ$VﱟϷخvTpm 'VC+(Z]JEDDm=iQ".333333333ɟ#UP?\(Pm&o뼬Y.2s%|{ˣ_ m+(.FD#;6j%K&GÉQ#0}\߮AiЈ=BdQȹɴ֪ >~e5 C^ :Jh8잕i}::3&:厅VSk@;}=.ӽ`ձ]}sDvm19#K)kE-#Pf#s7pC`5āk?yfL0 3;Ѣ+Кɵ5̡&#̹qr=19YŒuTmtx浺Aq߮WHÊL³ Ni^9' >s}%2GO7g*Z;:58DRYiq4{V>nڽPT#|&ҿb蕘}]ik͹>I*N1˽|{OГa^ F)h3z);>P~[դU90W'str;q8k4"agORbcH1ܥ׾8 4N/#z˵#E}Fy.=GoE$*}22?pXLݺKI@١996jf5{ԲdtZe1H]^>{fbBDW _͋~I&g'/ץ[M^Wj*{1Lzi&v%Z-je&Kr40r6dSFj33y3_QϨ*;2'4BNRu&!qOBX/gƑ9ƻf J*9Q}$:i%쌌'yPٖg9ݲ9_G &X#`ş\gj Jv^}ESB[Kh7elo)P?jye2#$*6vg֢>^Riw:QnM0>*V]V}Qy 6fIT~ cUE ]s]⛱& ',z^7d%m\֟ER""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""*̡֣\/N8%D-Ah0w_AהDAU(u7Q@@: SpD5(}FjRJ33333juC.2` zFih߯?EB;RI<}MU\ןER""""""""""ݡb]VZNKL|&w>ӸKgU(7<iPL m!l!=|4m!'iIa)"BeEanC IcIꌗ8:L20$-!)2"""""""""^;v=a#SW~ۇ7D%TŤU(1i"y=g^K{ܟrnFy??{M\_f<,Mtb.G1i;]/or <.B*V}S ì猵@lo!}_>;}7ꛞȹî>׶w8<N}Ŏ#‘>gX]8 )Ā-B_,8Kq9˧auR\Q[iNPf\ ,بqLl ;n:Č9u,tPDW@1&:x9RgVtɫ+r CC"Sn-P4px2> qk)qk1S't񾷂0q.zA5X(Zs ."gnݤDŮўV952k"u(җ d䳒F74T:O"MzwGTmEg 1}iv+PP.I3/m/-c4Bqw.*\i)ggowtapό^ [7`=hLx`YUvѡE '2vڮ@D@D@D@D@D@D@D\6MIζBKLўtu&qE%csDu(CM-Ȓ yx?vҴ5Ơ"3#g! ,궕S/:K&CN-[$gDD$[ u0$TԤ;2@,4f\ f_-֗jOLDub4Bb۷{ڸg/-Ό0hZ^P{2lqrlN .0Q3do]ü 69<16rj2woYc63o 0r',V&+wMJaE-t O(ٰ[Ic$G$ȏ2E;5Jn%H:3զlY1sꮠ]vnrN7a#q4J'$ ք`Ȓe*cbgƐ$@9Ix[ 3Y]9@A3)v{i0#)圶s -UȬ^֙Vc&\KDi<,i$VKj5ńi stnz+Rh~-& [)t/M\9O<vqwZKU38|o{~GynzXu0`A.Eզi Y(. $?ϺEyc&ӭ(жֆiRT###,i$7.NЫ@5/#P.C] Q-uk.cjլX/VƆYHx1+ꖆnŔƺi7pcNu5SVnuӡ_ Zjq+z;)2*"&q]A4쁌s"'yMteV: mwڶ[-^`;iȷQuԽү ՘č|dBInH8T( eO|ѳ\] 5i;2r503yuYpDvV%̺mj訽oȴَMH~pZ %:Vċ?+4 Ǯ#^׸O!: Ϥi_nU~Isj-5F3(IV:)6ʑqIgy.c×((V̩LN>In#~"c[["fY85##һŸwZ V"yҗK)pg<|=ѦDo AL8.-פiGQVtZiTo[hK I|'!ykdk&*xSa{FZjκt+MN%oGe3\EBRdD+=>ud f#;nˣ,ַ: mwsVe _9Lr09kt%nMjDeN=vy$x H8)o$Akd(ȓ&aHfڬs:ƺ 1;VYl<253ZkU.eiL!O! TJIe*uKQజpX1΍1̂9 s>^jThf75q3٤WSc]i1 ۞o2nj$wnG)ɬJ4$'[24LK3V%D9F]ztȌZZ;Ι8gn٭ .@1Y׽㶞z&S11(1u%[Zӎ8ȋf[Qw sekcN$bw4<ӨƠhEX2D9NRD76m>CΛʕG"/\2_򌛮@ 6{^ 4& &5H>ΜzJÉ$&P9+ыj"S{M%ŕ:C̨Ɯp9q O1`Jlj 5'(ﲅ"ek@$0> SwLݱ,)SZ)z9$˚ 8ri%H&Ff`q 2.1 ]%^V#$crgJ2-@'fŎ]05IAjWGK ݨ?Pi;Y"2dY˰Fd LoٔGq#bc]ÁLaL4a9/ֲ;WkVQ*]BMpFшQ_sRTn,*< Gpq9(ϠRYfCsh<* vVJ^[ӛYK딖y!ĥ'}(YY?\.~k)5n\㥗P:.vVgS^OC$O J#JRRȍ$dXdB]fsL3:bg~e|sm%8"rG(WMJnk@'''U5GXZ>Ϸk=RPFZJldD"-g3H 91-kh 'iۤOivQCZ^b`gwe;̯ͧ=>zFaT5aFLlS%F3P1"IjFјӕCF_MC]IrFZmp apx%ڢܯ\:QYA \V!rA8Qc R4Ԣ&dƝ D̪Z.3buY=AQ햜00Č&4Y֫غjRDzH2eQٜڔkݒ]d0 <.3@[#:j\H"N: t٫<0$e+7KjL_ex;2LYϘc)-"YdNmF}z r#QIx˷%hmwwp\Y 漈5kZt.Ja yeEDvW"K)SZÂld$mۙdRKC1$ ʮlvk57#"@;s^\zm^v-e95Qf䞐DfF"2ɑf}*Ĵ 9kN+C+Pb2ZcPA5}Ò33"avTjt&&%&?dKkAqlԋj=$lRvt)dXG6Zub7g_Zۮlʽ"֏2 _7ZRR>68QfFkYc',T1HvN.9F@8@FnQi>Jc FL ̜F[vJwҰqm!9w[{H5k56񒺜%&A% C--]QNArdf|oAk3scd9v|*Ug9A9猈ۙ)*_#\ye+WҮj֚vyh'L7,Fj&nFFG`}eSn7gNӬRsTm}gfS9 Fdi5W{1O,nϚv-gۦ"oz풨ߟ4]Ag%)O7'<Wi'D9kՕzvj29; Ɲ9ٯ*ZpH9VEZuKuGmSSC/*#$YJRx,'>7}eu3 i nϣ ׶8Z \w i fUskn3G.Dv緛̽5{E.ۚ"[rk= ̍Epe##RUi@r^2#*VV3dƠ3+6k}" $f6 g|@F :UoƜrQxPII?12A dz«ƎXJJPQO*%uɬ:[df5:8Rn3LzUJ-ѬOv'm@k nre.IzkđUkD%Ɉkt7r) []CHR3FM :lS9zU*9 vn`riZ;1LeKI#m͞F㼊@dU&2$ƚiJ]SfB$f+>9@j7"2= }vi Wv`Ah#qtGUex,ӖDz3\k;~W_rK1`˘ ԇ }M<'T[ݩKF*Z|Ɂ#6'~įeL 7 lY eZ4w9i:ۧ+JXSJeIrT7[RLw\pdaf4@HS1T\p8:DHt:v%) r=:}eUEi ޑZv"Q0KiJ"">2K$!,<ǧg$ T3FYTe+uU~Fԭ~`yR/br%P3!MdTX%$%%-mA#M2ys荻zQ fG ܳͥ{vt~+r\** LFDOeļ9źIcA$IҦaKx#=W XjR`r9L_ S2Spg!MI6jTiR Jy)Q2K*JloK@i>Anj3Tn9]))J*[U.F^27$!_$Ϣj߃X+6glyݷ>-bn_dѴuZ,n^9d,ќ,KjQV!eOj"U:cԇ%wz=G+=QZLω ;kxF#^O8!t)WkԄ3F͢Vb uEbVG܄_mr{IRrQ#c8 ]Q4̖UhaIsNY(<UQц3tr`5k"3>г:#KNܔ/8>z&^}B늭& byr+;ۄ3Q_:ȼ>w+W'o;W;?qڸ_g)ңU6射juʜA%JJL$e2/_aCR ϳ=A6a՗Φ.~}i-}vӨ=SkfO N˸.8Zö>1G4`̤QetfqGBFSjR.#hvFK=rk9:>Dbkr"YUOFeDiAQӆ4PdѪ et$nDŽ6ZF]#d:v)u,!FZvTڶ6ދ\vfJp#BL)3$Vd|OxD&TXs.iwN 朣eY0  KiNӳEYh5/-I$*k=K(H=UL\R~/}mn qR3z+ELޙv!LCL_JrVT.5#)hn}@.voΎwz\oU> |{zgw~QT\mJq))34 ȾmFhH8f{%#FIθZK_m4,gy٥S2 >폤SዔsNy6 YF;=i 6{Z);%RUN`jn) 9PZ܊8J$${#2}8k҉{C_464z4+0Fa'vFUozT p=H'9 ߩ|}>+VTP !Qֆ9)QwFYW̖g9G$*p? I0`f-`*}ip۩0b%o lA=F4Lk2jIb"g"zD.>o{Iw@=+peb{BŇbçʁՆcoI[Sp;pXMutI~q1+l>Y0q10[L˂bG)^6SW_g;BQ?~Ow7PmY~y#99yk*UR'R#@y:( 8,K"ņs:puN|W퇍3Uڮ48Z#Of] mm^M_ZU7 m4[{ bhn^ $ Ү5mL4]iQڭ UgPF랓FGзZ"T.SL}9(ڈmZm:ńO2XK+fcT+--}c0^E3X,.˟EflyɎ8m#TTQ)&ձ8 9d;y][H;) ^o[oj m@7-SV[#&NI]$K,83W4iI0jcGT]*_)vF4 GS\ܽ}tXWt;s_.KK)0@31:+=rN0pΐUMLҩno i9ʷTe* ':썅<\,U3A_Nд8*߂#~I;XޞRHiSVڻRl8->ڥծBϣRۋ2IըQĸad:k?볢nʏʳ<;m$OdŞ9t-Cj3!9+U6:3?c,mZ Qe}I*W BNA[JCR rrR-H.'KNyF3y5Ԑ3`r6]R`J8΃ szCu&ib>זԒķ< FE\}IA$r-H> VzW09:˂j,86 *s܊-ܚh´ʴ'wᷡ?ղ#99W%ܫ"ѳٌ]ƿͲ35_?'K:Mջ%ոF2&]۱*ɪ|·iַjP <#OǓSm2qkJl IYhGLJI}S/9`306:VkUac93xݕwC ̌ڴfGLt:i{S@[\ WYP Y?zH,`8͢FzbOh[i?mxnJ™*cX.#9VxA =+;\+I g+kKXULJ҉M (8LpI%GDƼJeA3#ukLuҸ_ UKf4cjEu 7 } IG*jFMڜs8,{}QZ^sz=9282]#z]I (!iYE/$m%̍eQ8G 扨猺0N[l`q f7ιv\L<.P5B6,ehUӌY44Nr(&%HekzϜ+}](G okW KZi; ߔ ɹ$*6OT~rxq.!iCIZdFY">8qꌰՋviΰ<e5} ViSܱhXМuk2n:lm4HR*Df\2DpQs+7SU:Z=ehmXÞG8W{S"CL-m>- U~OKZj<t4FJ-%\2qVdҿ8K ??%\.4[ zpzJ=@=GVLiu*VGDiby-fN-i[m)+##oe,FyX|*,q@8fy㣙[a2AV٬I.M? Ow0Wkk9*0;GTe,pN_^/K(Wgk7ীqػlI=r $~#8,2Z6$%^D{')s #x),=16AUH瑑ݴsꭶu9fw:#Lf׵uV<1j)_>{S'{r-J 9aoOժ SlH^Ѫ8ǁ\V)!VZ]vm>_?*-j\irdMSj2%1ŒD9TQ*ms;+7Q@3fZ 6:O}F7$br=hЅ`I϶5s:TMG|.9H< ˃Z]2fh9_$ƴYZ8C+$ZYZhG IѦU[rea ^5[23A 6tWb VN`qlGFy}M5i":c[B{&glT>6mufkKLTF\xx o9kF!zN\*5p l+e>fDA3X&'y3ogUA//+hW~J'fw}zj?vwny#99zideR3-է%HK ?¥_6yzp}GjK[~ۿlQ{ N6x-#=. 5NӻI%*řMFb#YQ']*ozc'fo"Oj73 ũ^ՑҟER"""""""W_<DZF[tRa[V6z擉mjmDheIRL$dd/T4vm 8; V;~v݆S0e@rNw.ǷvrӛzMHU7[(ZL̕,o|JpEH~חU1e2sݳ}\j y@"Vڐ/oX9Zъdi'd'yk3SfQO91Zag2;ƍ"%t5<Γ?逥R={w>}=.Bi$6I)It`g2`` n@,Ux+4"Rn5R+SFDC4(j%p#:UZo,ppA\$Khh=g?VzM9\iM;pa3%մ As]eyT6Ҩ*4FqȮVޥl7c6^yO%VͫSigތ8 sy!q}äcʛKֆ8O) eY[fi(M2<$K7#43"!)#dKK#A3E-NV]PiAl1ALQt*žjT6Tko4uq"#? EƟyl?]*kF-FݱfaYF$h#Xӻ1ÔPa#㋘ kREڒR Om.&y"6sGm2 9 3:gv`sBVѠS-kٴ*uDjRcBIUIw*k0 s%veTyyĞL̯Pm2HQa34u&)22E4;#28. qi\3e7bUnں)6&| /Î*[hp?ג:H?\ pR3ʲ4Q~ePyIoIZ2Fi<%$fEBRGp Sm=&#lPK !;Au"Hb"5 dnA!&JRYq>ڪs&9u߽sDR``Z֥ϳXU2X~O) z:3y BEm] 1,ٞ{UgSp{LfVlצj.7Q!{1rYClx#"#nW']ɜtU EV7'{!{-K MVP2>^mƔFEBD /R9=Ahi'Xu׽\bcN`@9eRLR|@y۞.jT&JI"']pԥrY=(ѨiѠ~ʭڧ>aΪ/ 4ꂽV9Vj\'cTu.+OR[m[3I21\eẹ 'zU+mZ0ҷH ־mP[kN񒍧2FBдTxLq-vɲ6FªЮNa64:\ܤ%˯~t~Uч{;>-kVL*MLn |Y#*[qf)X",,`SY<-n 3)x;u;OAY+uW;Vh=C"TkU"rZyR4*WDGhW4CL!=9.mP̗bI[SJԅ g!jN(zOMJ|ڠ-k40uWQgzrfA Uc0  GR^^ "3n_Rɳ٤?*Ln<-7[ɶIk0ՋK%9<>[ߜ ?SB빇xy<&{;>-;\Y4YF,֗Mf+*3%g@Zn9@ڤРM 2ds ]FAI3ujEl'')5J%O'׃~Y]\F}äc֌8{ǡnbѷ,_Y[T&[NVV"5JY౓3`DBzNDFR,fu:ݠج뺫dQԶjjUʚSR4뜢C"*ekIz".Tk5=y\-68D]`.+lӧ5|( XC)KilgjWJl38De2E ni2LfN}P*wfu#.s[[P0juXiA)dj'#yϠȾHV=tlGW d0'h>g"ʷZQ쪔UTq )}_M4JRHt)"9Zj5D-Ν}YRHR``F8=ЭIfM7Pjs-2(PHhIQ7A䳞~v7Cuv@}OyU!!d>ZV }7W5 :71kuoviYöťg\`a* q ojZ Ѝ[FSUj=@ы_Q*Ha(LXB &Nx󕟇T]ŒF*VBCNN\+{Բa eQq蔚e"r-*+QSF 5R3x5^^uq$ƙJE& V^Kcߎ,R$9E $X"YWO a=]KZm!cYSwk6TSz}\wN#^\I ͨ+%{ۇPM+^Z ao(J.= ˖.tYa" r\'٬ЏV<&f}&bE lR}d ]/jrKNH"ddZ|Ie9l37b:а+{ܟG}R8Gh 4gIBk]vRY +L"qB4cpG122<%'y]u:Ze\V5 4mގ.- ïUA& i4򍡶AҬ $+Դ9-v}ZNƼ?X r<<¸گ#sdzdL/a腩kZZTǡH oumFDf{-8㧀V4C<ak'.mѹPoW 7y=-LVDSCrLBЬ[WBS9,r sckqgw$\KE1M@#@g FwһGQJ2nt4l͆5!-OpIZTY<)'z22"ϞehBg3]jqinYCeƼ>L4[X | zI[FSխih%˳V:Nr\~o5σ{8[A--:~l;WG^C0 g|zw5z\J/n+r(J+Ig sv;{vBlt9nv{ԥDAPg1ogJm[ASjuؑ:#aׇOt扦e=m8pm$e.3x5&z uQF$ y'}hyiGRTDDDDDDDDDDEӟER""""""" FGc" "-"fD^1m幃u*BGZ8vsZXDt{@Tfc2u3M^Uk01@6lEWPɅ@Sf̩S Tj&j*! fIIΆ*{G#de }K7d*C>'莙=O7?aZUSC>'莙=O7?aZUVoImJbsk/8>bBё8Ii .=HM}d *hUh503|Y""kϲǝxt{Ny$VgGӮ4.CJ#<Jv03@לu mqm$1 i$4 X_ֆ},O38}j ?j诸J{=hg٢?]f6_J{=hg٢?]f6_Jmǽ1veCN4Qj1:qsw{pgZ13ͤА"t $oV؈o]001:BoDE m+J`A D)9,;fxEr"I @s̶jvݜ-gQτ` ZpCcE~7Rw?5r(OrZH'VML~E{os\@kI-4h{G5fz =,NUdJffr֗ZZz2̌x ssKr+M%"++ " "-Cwkؒ]ujeP`N)h-A9?*O4Od76{ᐜvNy5;Ovp2*9!KZgs來imòO4Zŗd:V@{_xCˋ+nZahEQ5&S[DjYDw (,&Yᜋ6@N`sb`n;Eo,8v! &WV> " "-iR֍OJśJSS̮ؐè<)ZrBT22#![)ߜ>KƳJvzk!B`ryZmygY,g^uD! 5JRx$I!VVpc.qA$5'`\̀j$@jg a+j_sj>YRcCvҗ1y+5Hu=Z!Ic$XȠM6%&t+[Z]fR e7s@%c^Zh?DtCf*FQ*lJտV]I4{ʌIF6iKB&\%9 y VEiik` cZG ΫԚ=3*><O!֜%E#"1[)ߜ6dv 5*Ss\m!zϳE#~}O7VޟkWS [*TV*jZ*^2ȑVӭIROdfBS[s Z<-sIAdA0yU$@DX~G2Z=r9^1i%r\wӜg,/1 @1\msRS N n|L& NP Xֆ},O38}j ?j诸J-ڻɬZ 2礩2Si2ٛF7NYY 0aD0G8!YmWU8D-pN/ * "/[ayIJ)5k2JRMJ3^\ $\2vmE3b~韮uY6_)fGLt֟*a)fGLt֟*a+N֝OJ͛TT^DxW} i R<+; 3030\L N 9*6 ^4jUkZ$j5 I%΅lXWń\d橗VIJKq+hp_[*RN%6I "2,dT-.5$mW{m3ѫQ&S{0 KZDrV=fGLt>{oZ ?j诸J{=hg٢?]f6_J{=hg٢?]f6_J{=hg٢?]f6_J^pBU(2Z 4jJԗZ2Ȉrތ!rKCAtVJ:j5 \ Hs_zϳE#~O7^aZU Og 4X:g]?ߜ>ޟkWS Og 4X:g]?ߜ>ޟkWS ^vb|:U'VlڥR#ŇO~C8d6MRVYiF `lwIQpZRZ%ΣQjI-t-+fJ¾ "'@L"-%u!6KFJddOE'op+fHpdewF":8Qz;uݩۻFP-"9tWV-v\3"PƋ[/8vJ?1rֶ :no&!Ni >Se6ˉR,0tfp$ XUThԀ@CZBCWDE+=MY*ШTx)%ɝP}I$ΩIdȲg)ժb^@H*Z^)QkZ %zϳE#~O7_?aZU _JIqTѭRk4FO%-ԅG3@Jja9jrQ|٘j֡UԪ5L % !i[sVEa.i9e6թR}JZʔnCͨjB#/U0KKDUp[m,jh1֑0F\{=hg٢?]֦oOڵx+Zh?DtA8}i ?jZh?DtA8}i ?jZh?DtA8}i ?jZh?DtA8}i ?jbt]yPS-TZiNg\ޟkWS _5CZ[oYlUfIJSqS ρJhmW09I02I..}&\BOF9tj _V}wN1%6h#3%Ǐʺ),Ɉol!9vNy5;Ov. T(Tp1Z;-i+W;.{(tEYyQq;]@d%?\塮A~P+u^a55JYGp*"ReȸSo8! 8Ht&:/> ^QbÇoBeq-!mAc"".]L{2sTPmR%%8/)I'܇Qԅ2F^A֪` 6Yըc)%"`B+zϳE#~=O7MޟkWW%d6ަ5e6Qe}ȴz9ϡ$SqqD5gɐHF`LđT}l4>F0Lo`&&%gA 7U|_yGBuTHB3R2"""ə*I0+^CZ$ 'Agֆ},O3Х8}k"ޟkWW%=3b~韮t3~pz~կ_L%֟ER"""""""""d1z&TR~IHOz? yE׽mc<'OڎC[忀ZQwU߹JH# i/eԖC(ntˆ.j#8v)kYDzfg3mwyB&hmJ-,KWUXsb\wf37\S'Ffd%RYhb ?Ŭ e߷MLu0q@DQ?<ѯF|WmKZٕZ:V) xzh~pU=&aQZ$溺˻U<_FG˂"7_V-wߒU*SnOgU`b5DEvvw=ip+pZ =*zMEhI߶6'T n׸GOeEEVQ]ҫ" " "+BVrx1F_[7j0 brGzC,Wj{WTW +.5FT]XM>ZM[HQK-gx>8Q Fy5r1qkW}ҫisZ iŨ$dyJC5 ܶI@D@DS1.*ݥz¬5xt3VͲ3Cqj$''$cY*:jq2lI9R`BLcZ\]"$yj5%BMq.ͷ*[qM%LȖvڷUH" 4ت0oHcڹ@X-RM"[N)[JN xTҢx̏WDi,? C{T 4zĮ4V_U**~'~_؞P5jsj^?ZQEwJb'.h/_дvt:1kMƕdaMͧy%'yeO$1^㑰#j^V:Uqk$bht(\Rە)fFFG.$d91`PSzp=.e~:-PJ$,).Y͵Jή㴒LvR͎{(nkCD$3E3]-뭗ERN=z0kwoն=/**]u.dFOM%&Nj,Y#2 ʣ}= pӺ6H 2$hxƉ:W +b]-WU'\O+`^ endstream endobj 16 0 obj <>stream HRAQ* Df4q!"./#T6өpE_~ 9̗N.A&udiL.v?؅s21 d.\)pU" g/,Yt&70.L-2FL ##########eNvLrdY D/D/Y SvL2XX4baⅥ3¨Lnja|&/ vLNFFFFFFFFFFFFFfX#ܿ pW_fW2YnWγ2 יdG3o??? `t\֋d|K߷2k͍&@ endstream endobj 17 0 obj <>stream Adobed                       q      W!1AQ "247aqsv#68Wru5D $%&'()*39:BCEFGHIJRSTUVXYZbcdefghijtwxyz  g!1AQaq"24rs35BR#TSb Cc$%&'()*6789:DEFGHIJUVWXYZdefghijtuvwxyz?"RQ(DJ"%DD"Qt\kMގty٩m|r(J$'pG"ju4A`22NQi7ULk&WLha娼+^ݓO= 8> d|^3J'}0k:SW]P86cc* R]q[NK V1k\RÀ1``oa֭_Z;Ǎ#x i V%+Tm%U_0V*TW;Bxmo"=6sP^ZL%[ ObzM]?MVUY_J[5(ի\xK.BeTm-I |di4\љ'%Q=[ަ.%|jbq@$>> \UReܑAÜ=P\vښɣְ*4v5G8) R)kQRI$'IB *(fsegSnCpd/A{@[KͲi0Zo98& NcQZemT6mym7KAp-k 1vV<`uI  8(Y9c7|,iY/ʐ`9%Hܩj$%)HD[fefI 3i y0'Pp@fj.Ni&*Sla:[1NO}i'Gm\8{ގ9^y_ [c*Ve֝i=!5Յ}AeJ".A sUyi#F!sߏӥ~%:e.3WҟK$m%5:*NsʬK|6ˠ0ov]"VJpo@0sNrS6\jqۋ7k2%ÖC87wA0w {5]AAH A`&Z,J-sIi0!GUİ"֟;W}5\u'yOVo=/@)TV#|ȭOdl?\j4UU=ԩl mD_+C?a卧~^4;먿Tv[ Yը:ثkҿ>fIi cR_a1i(nd@ZjS|栘ͲU{&;J_TF5KYuAZ?u  z>ُ ~*^MCvk_1*DEyz4}SUv|ZŬ~ڼOEYS%zk𚊭jf'}6̧uܞ4"S Rx^܆$$ i {lͼq'љ?u2~ѥ-لٓ7Z5 $JMwl: ?6;nyHmƹ9*B{ll6@<Ω^Rwpǀ~?B484T3$!dr +ȔDJ",Kջ`~_.wya$S; ߶[cꖺs|u'2{3" +㽴{ Vais92dP;<ȝF=U5~CQ҈9<Czyˮf͔O7🅪i겐2_n:[*[0˭"y>0Y) *+_p|vEk[wK%e'P0ׯͲZUn<>u7'N%K+7#`*8H# c5 < -T+pٝB?6 z.MA0G(j|O._lO jqoôGOԿTVj*=k JΔDJ"%[ ObzM]?MVUY_J[5ګ塩o3_hXgD/^VfK^(Ko>5v쥗SCQ4wUm^Ҵ{++4(y9/.Mڬ66"T9$ Ե(#$PY}r@̐+:*5{2uPYՙ:u+е6Ųslm'Gm6\8{ގ9^x;Vش;JU֝i=qz¾ Ab9*< # 9:30o?RӝtiOإ6䒚t~j9V%L_e~7j;.cX[87 `}ט9O9);&]bɛ2a`_h @"I]A $AFb0_mvJjT4(XtPyvb|θVn[5~Su/Z¾ҳym@lrdɊ":N6H9دcAd/ IHA {ǩ=r]s$kV!l6le.͐jtGoԃ¡e$;[u5AA _-*ZTC *!]9Ǹ^_w+Ӿ W?*N^VjZZD_П"RQ(DJ"%DD"Qt\kMގty٩m]Ŭ9'?~5t^zVTJzFVۉvҠ|4EʂE$[EtmZ,5藴dFGXTyu.@Gl^{7רD'%~X4T?V4j`v&71ZM_,sC2Vێ>4tcʷ2_Ku|;-uEAOI0n cQ*:K];d@zwHr,ȒPP/4i<WLJ )2"AgW T4o;fKRMJ{`Wt*C|<=˔ٖ1K{+f:W^-tbnj=HTsd-q ӛ Oh>*oUiI'eVih`F Á`K-WP!sᰴQ &0,x9)g!Dwb= y4 OHHmĥ\$cCA DĀbbs<-J,N.T}2Dǹ 9:MǮx~cX,g%0ྶUrڜj)*BIZƜRhCL\nEj, >ÜD"w|1~RTx:w#s,dj3dIe 8R +sіZn5堞TI @Lq;WzvbeJ`ђQpiII1`Bf# lx.%Zl.|\vsS SC[}^m{}KK|yβRT$הW)*Ep_B.%[aul6m앶gJܑʷӠCsIh8$k$es'aUVج|_uH.hkd;Iy)q: fb3XRa<)T 0|(53 GP_vk^K;+TXolN\;:q9Εm '܍',;Caʠ40h3;gj4Wm1c#XqUQ驽AڑMuJYF[M*:dsr"JT$B@ެVGtI.5ˢpXH '&i8as`$F*nS &䰨ZB^I+L#Crnm^&M˘er06TW.%0{'dw~'ثlC*]i `'pjIqJOR7QM-l"Ǐq<>"T e+t6;)[[Cj-`0@#[07Ko ?9ZgXtqXK_V7-lvsD*j D砎[űZ7ƛ @@SQQPVu(FI|hYrwm۵,Ke}t!Tx>ԝ ֥/ͫ ֟;W}5\u'yOVo=/@)TV#|ȭOdl?\j4UU=ԩl mD_+C?a卧~^4;먿Tv[ Yը:ثkҿ>fIi cR_a1i(nd@ZjCP,h .#PHaăL\{Fnk^{(RhJC:!I=-iuB+Hkgs浰渵Öсp[[[G,m:M",Ȗ{yuRT7A~^."F HA NNQ . *1qW2^ ˷u´kwAhb֨TzM"uӟw=P*NVBa6+b#ۋZuҒqn.K88x{{vWiy""Y m1\+^hu%dC #A40`Apv?t+;B <z)>_~VZI2$% ِ};5-+i_uKdKͦ|eP2l[֝JVԴxw:HPavǵԳhsZs\ZhV8--y&mwKsȑdK < C:t*I ׿ASL#HA khHaVYpVsGW/Q@_VYcxn<HWޘ6Q%Ĕ$FF jk p?= ڟFگ-uX`d'`R)61ʤcfed&7)- hqqCtȘ \B9)Q(, Qި}) A/ 89ĆxۅjhȖTp# "d`}]GNz kqouB٢LwvzKN|ʳT~%kGP 57ҵxksU{GbUn}!HD^{` Z(=ӿh ʤ`8HױܺF-'Xtf !G&ފSi&/\5!Nd"T e+t6;)[[Cj-`0@#[07Ko ?9ZgXtqXK_V7-lvsD*j D砎[űZ7ƛqWu޴%VgS= t #Y8@_;y,ۭtC*F{wFub¡$&p58jk#ا_+5}gJ")\:rv錩q#}|6Uٮ.Lq4 +WoĮR*ƣޟڰUn'Ǹ^_w+Ӿ W?+:yZ~XVDEџ"RQ(DJ"%DD"Qt\kMގty٩m_ov'H01W['bUZmam+~J-_T"M`ڲL3S iiB:vM)I'֕( 6Tm姌khI>0,j=?) gӔ?7 ջ |*~}7ut}<"גX)Jb| pQ72z^-[vuWׇݏQf沯J7|ZeMp3E1ۑڸ5•ۤa)+S֦Eo?%yti+Yu) yH~IY=Rbrօܬ)qS`!H[nvq%@^֏.$ wD+H˰h5h!2c<*0#oWc8/X.H:2UJ 7Bv #Ϸ^-/AљlJvm&USq#n+, Եƍj%WI[[n*Uis(eHףJ*Ͻ2`& `f6m5&ђEnȘ̼<XXBE+W[%uDOkd`Wiɭ'%ULZg$7˲n+ۂCZ@@j,,s+Hk%t2h鶫rsCj`27W$ieې.eג>{kPj4u6byΏh~yX/QBٺ1DZGy}j嶺qd>yޑ_ **Jc^vQ})썟QG^JJU]ڕ>5>譁͹((L<2ZFy:}uО[~5}g[uzW:G5!?=jKl?f->T ٬ MTPߩC<;FFMTK<ޑaկ>nd773mGUs@ a{犑Ha+X$n u%;bm?\1,`/x ovEۣlumN$s# Y]QtW-wD.evj`Lsi{Cmo5Uսj}08zi6m3˨p;n\X/w jhm2c =iq )+HvV88959%}CHYl=Q-4[?`yd, ų+rbd ͥKGmcLpv76n"l/}}MiGmEPDyѯ>M;LWmI~#V6喎j'j )=h~.n?fxk8jbQ(dG5J=O&D4ZTE_5G<ԶR^o *\bLU*QB?IۋM:Z5jqo״GOԿTVj*=k JΥF4N/xc*ڙ)0뎷rҜ}ԃVhA1!X֟m/̽v6mkM7 Ut9ĉDN;JiU>} sT;>~8})eRJt Fo΂8Uٰ+ MѶ+ӳC= & 1'h'M?tD)ԥv>Gk @ҾSɿ*T^Jƴ}GܕVbtuv-_}WUvT }E^3Q3io'nK)ĨFE:p cQT8<]p0@8UZwL1怶cZlYpGkRS6Bpqq4 ;ҖVFLxnn<Nt6=Iq}2WqהV4D֥NcCF@8&hcDP!gPEԧbzZƤQʹ6i;m[=GhR~T. ]{,v}3Ec3  '̱Uvk\%f2cm)C-M)$VJ|WWmf 2A|(2uZ*InѨpWQ)۾R@{wJ5,TUd9۩Zt{mm~iαn>Ɋ:QEscZ~3/O =uZ9 KEآvo"m nfuk<*:J(DZkח~zr~ob_{2)T^;4> [Rմ|*%ձ"Ĵӎձl795IċV$v-5 2$y)z]U2\I'i&J\dN$*"+$~ݙ-2-V) `P]OYi`z>%fWas\GR-[ C`6Imv:GEizэĮYm6nNhp@#LB!;jdm[r wbF[y'nB l݊ 1OtN7c̵lע/#E*mjau0@ fLAk HV\kMގty٩m_ov'H01W['bUZmam+~J-_T"a{۵UvAZt }˴,UsY)fFIRbz~j{}ShՕ~_u'ǾJ}X(H1NP`+Vi;UP^J`)2G˭Ex|o^^Gv=Gʾ/)xbw/(&%ZwQhP B;uwu2#㈐p+Z2@7@#^z/DnskZ"q̤MB8  =B1TFjxxbfvŦ\Vq?y&/ Tbc[ȔDJ">Kok9K&,.օn3YB7ܴF7{IR`rNmd?UHu{E: ʐ;2p{b}9M\{'toqf~3쫉.6 SkBlAU{ vjp) p!~R6C3 Q֬kP]SU\~nH}? q|wksղv'>Geh]yz2[#׶DD";\:/k>t^o;|,[@;4zZjO%}'f7^۷'mmGܝ~h֯CJ]=Kw7 U]ڱ1G^\fCMW/g]||"|vUOK U<ƽ2+gS?M9|O@%*|j|[rQPyciߥ׾e)t/<Vj*5j:ζ*;ZtkC:{/ԗ>~Z| WPX :ImJCcZHMk^hPsۜC|g!xz E;HZYG8a%QjvMnWE)鲝=>zMiԩm t` h ̦ ;< ?FOs m!irv{}t@ױ]΍Z7]6 1W{zig2?8QoJX;M2ȱó RXAgH|^'d4]M>v~gIw+ ߩ9:f Zu)M٨~4K~rRYJ>[t:>ZF,4LgN.ncDt]'495 wEΣUTV%Dyѯ>M;LWmI~#V6喎j'j )=h~.n?fxk8jbQ(dG5J=O&D4ZTE_5G<ԶR^o *\bLU*QB?IۋM:Z5jqo״GOԿTVj*=k JΔDJ"*R4ϯMl{)eTM!/k[W=J M>p "Ip KnJu+{:E遏Z;𯾫b;h h[*Tl^>1okkBY^'d^ |z_]b;_/fUnkZ1fP*X=R8{Ǧu,uǭ*Bbt ? .NxrXdʽ%GJ"%DE 'Ĵ#2NBO+v P)GԴkKSycz//vНV67~$4G,*+_/PjS\g%a#dFI=m$kǴ \a~%K#E&hQ**.p#@1E$sqZ|W/$xa%jM3L.M3 G2HF=Z-\1یku㸗ƽ] oKK*n2 n;ZH[ΘѬ٪YF9t'5[Bc - 52r[K[6;eШG61#vϫUzPC6HPv9?˿ĭ?NxK|-FMHSvy@?Qk;76߷GOtS5|XDJ"-e˿W9^g?_7zx/߽{fPy/{b2[}q?d_Uە]jUϵQrN/ +n ڼ7|O@;>ED~:.n_~lϪ=YZlGk힅eLê*Q(k&poo;],@{:?3Ty/ c;5hw?ݾ.;mmB>җ]W嶬ҌFWW;ې(g\+ExMN-[)jEG?K#F?_g~Gζ-q.&a7j[G-{,Fs%{ȞSy_z ؿ K&msvq1`F +]fKO9r<IK:Ҋ*߭=DF b8*X2[\#5 ޏ3wLgt[ ;IhWw̥U0ר_̹|b>u!ٰԦ?:'U׀%ӟ"R(ٴ"%ٶ٢"ٳ\kMގty٩m_ov'H01W['bUZmam+~J-_T"RrL3L-vR܉B#4v)-%J#֕+֓Smߞ$Kh6z5+&\cJDkQQWVu9^~#9,۹l݋"3jkC j%*J mC4οvҭicMQϦU2V|V%EGG!rZdOO/vN]ZW)LO?]oZ+}nο*>C=lԜU( (6 9EEYRjH鵲%@Q3vCuBպĨ* e{Xpdä}KX R_a,P!bmj`%;㒕Ķ]j+rCi[iS;~+^um }`{->{|کcƲiGxTZ궔5L³Xmǹm2z:ˑp7";(*BH@ -0FA_Ϧ,f2H s\3i6 Afk[zbn+M-O:պEJYܩ_m  ( Ğg\NeϠvI_;bELϻ//kj(1vmbSO㷉%]|=wYjivp'WomNܪ1&,8/M Zcw7tG} XqNƭlc@k1Qs5]oV R{GZn8H[AA { ɎqRH"jMŎA !s-0p#1D_UcV~-K=ES 8njz{N@s ^>Y)sց֋VC_GF&w߅r][;EuYw65d I1hLZ#/27Ɛu7L ^y.2{K$Od?\jt25V3Mq-!U-RVjI J# F!s(TW"c.j 'wcՍIzc>kGFmo#Si~SԈ]#M EF`_rYŝGR:4-%$_PmS$~5 dپǤ v3->F508n>k޴+ʰռ\o4'-ϵa7گݶٴܺ(ҡ5=&٪4ܥE5G<ԶR^o *\bLU*ZO3Y)^Eaې7uɌiyv+Ӵ쯌o,厖cxhTqׂzjn2㌺ۭ(hPإI;G|Z\ ^,6^mpnB<>1 Ϙ:UfVriL0wFN%i}+B]h\78$-qm\K:-)*J9E{ni *Q(ݚλsw{+[yH3$6¥Jp)~ t?k7c.*9ق.;pخk!cb[N߁~ȨKOrRN9Ȋxy6,繻7$$ݸ'4CkT7z'Qj+9REscZ~3/O =uZ9 KEآvo"m nfuk<*:J(DZkח~zr~ob_{2)T^;4> d[c~CRV~|*%lj"uӍ(PPAl7S99y*Vv+-2;xoRT6;GyhID${ZNp']v, ʣh>Ât(XN\|f7|q_-Dwеkdj,9NANw3^J>6k0Υ'xŦL#nP`>Pgܘ u!hZOx+fIXA?3EV5j*.I~$<#,0d\%8KQS<&iW躧i9uB=h@hoo7to.n'}W%պôWZEscY@a vK0M֎: /w˹8 !vo%ǔv!Dح cLw;'}6:G9h\,.T8\oK}{b$&p58jk#ا_+5,.kԍvzA} :ڛHW9fx Co j͆ oΝni$!T\;rCij[Z;˛)s#qWݖlO.fchY;Rz޳%ԟ"RQ(DJ"%DD"Qt\kMގty٩m]l8NYf?a5*t׺&R 6P|4{E`]E ut]m!YZهCYTx=[^Ҕv~Xtzss+uscZ4r6|^o,<8@qjqՎXBAx>L9,>sc=+:~ƾ{ <":H^W\r_gt]9*d q%KZO;]~YgTkZ` hdZן0 >o BL؁|rOvT' <t3 \{*nTcu`8k'PG3mX;dq[F? Za ܀7'mum0 @d'k>Qժs\㴸>r/&.,yَWgKwbEtx : WFq\ aC] 8LĐ&"s<=EZ--S}B9 *9:7M=ǭ~Y]Ɍ,"Y>SrT⛎ ZA$mZƜRi ܌/El K&7L|1~RTx:N#,Ĥλv3WH y 6T;+sіm5T , p;z m}JQYMqh8A%I1f/ ̬yr-Z.<\mcީ|bHdH9HR6 i-4L`=a1^sXH]`nd^?}|S![XvҡRRT T9EjuK5Τbh"TA`@# i=CHYmt-,cFC긍`"VJBU3I|&mZˋ )l߱$cT[Yߞ͎@t gwld 쓴K54u@F'0xt\hYuWu;M2 X@S wH )*@cqΥzqx=s#"Aka|LYL>PC{{ 8eTS]OS2~b ZmnmAThpO!4& .W V`^묳Uw4;]8kKBUƹٵSY0`;)!uW!H%Jsd)ujWU"/@`̟4b54 /pZH ҕ-IBV 'Uh s$`dlӭӬJɏukK#e7&cj9Op:;` 6S#=Λilݘif#^-}Cth󆂡Qk=vs{П@@)+žl}sx^3pȯ}*mt}Cˣ%]L`5'jQXe)HZ%[ n]1N*N |@Nˠ..3϶Ojj֊ηhxRsfs``OXR$M]1m. C'[l::^ߟ4n;̸az3mh,fuCWJk$=5é9쥷Y)d>jiFkWjRYWՅ@W/׫AZ3]b8/4#JFYZ jFjϺ.t̿ev-hRU;l\ s"1Ȋ\Ai\:E3\~+9CBZnJ%+fҢ$r7*V Z\Is bM-8Gz}wT۬vԱ5h͸/9&ha DdL(ΦFK >JnT)1JuC`a-nIl; mIҤ&dn?9Zyu66Numu$+n5S䈦 OK\5WpRA#TJ;rڴ\9dY0Nƛl,4"K'!-V .TƎ`n:̒H6cuh% bId `YB0ִI>`%lz4N- V5gҞmwkeJ4lFh4ZjZ]QLtDʄ.Cwlg[Vpnݖ;3|֥nUvH$~E=CXubjs]"b-p]-[LUͺ]$tm! (gjeNI J=NIժk\ ' 9ު?ynIT祿 ?Rު?ynIS.oŸsA_;V?R4=;|oPcQ9 Ғ-hJWlmTŇ6Ď fݠ!jFZM6$CNDjU%䬗y ͪmtpLflgv)u*n%vVn8&/ Ŧ5 *uUЩ޽iAU"V8Y ;±lܤ-5'piRDmF ͮ8| ugS{x(d(O;Z5i _}ܲDA_-=G=SZ!Z1sn 'T^ܥlŲںHo ŸiZ"EرC&Wlp_{evҚOJ>e}m0tܘilQJʟ\/m[)GthN}C[|R?{#i)Gt?jw2X~ M!\y҇XJVRf3`$,xvj{m6v sK$t9't)ic@tmSZYv4ݖŅ*!P$kΆH|ڀ"nN%hcTǀtð)> VZI!$)$࿰;5-+vX㰭˜5ߴSS/y=@@YWsiYr=j":TvJ)RS7i4l-Άqq4.v/Rn\y X\R&ɓ6[*[yVwRqEJR|Q  /`h`j0rE7Y$]b.m;$D":I%'` \kMގty٩m|r(m6-]PBT)G`̒{BMpkA$I'կxh$NYS=G:Ӫ>y't;z4⯅ۑJB;M{M ՍWy">x [{#iּV2e2;%ߙXP5#xVb1HD\]nFn >AI_Q1ulɓ.1ʻ+Gw5cvs>eΕy Um%U_0V*TW;Bxmo"=6sP^ZL%[ ObzM]?MVUY_J[5<] ԍHcO/x&)3*uMɻ[ MpF \2MGk?K*! c9oQJObڕjWoHi|T@d*Rp N~ѕiM[V,%@{e~Y9A)2J,DU U|dʼ]&<8LC†J g>iq8m`ZjUpcFnq hL%JRPujVn!r GXCpsC0se8mi317g3ԩ8!:0\5ָͪMjRjղGjzH_Z)BN= +t{ܯ7'Se:{ky|(өS2͂ MLX `I1R[.[^_H(؁P~n=,y ,ez}Ӝ[ۗLzDs ul^pf%xND3pr9Ďb,4yu6-;JvT-7̾L;Ekh{Gޘ`ՒC}y? Gt%?),GXOyx:-_D[ZU`N&3rw71sW.zԚO  톻Q*'tυ}IqGܭ|lʴsQ;PW!(DJ")W2ϘV}J[0ZH5~RDWG7>e5[ga^ūZM=TU2[.צ O._lO ѭS}ֽ=ZQQXWVu?R~=_Jt'em>^T7fDZQQ2oqla]yzo**StoZV"Q(/SƏo|j¼7Wص{W*d]M~QUս&u f19$=[<"TH7":ԕ;yl$W4{m-;lݼc^@#`g[FM0-3u9u# (!MS)_i{$ZQT|ʗ̃) +Tu9j9֩Z蘨#~m;  >ؖ 6ʧ:N :wh) ƊƷő(9ux=Hb5at2"̭=+v! T#hi}*'p&lδpU2}J9`b  G 'Ĵ#2NBO+v P)GtkKSycz/-F )13'>⳦1^D鰿ïӤh۾i+ԝ1*ͼrz<ZJϊ¾FJ"-q:%i޼ onO7xd#J֤|wFrG8bߩ-|iO>*+h.{Ogƴ%?rߡ|iO>%] ύiJ~B>2ҟ5W}_K{N+/X]@W !'Ď]B72d&N8Bq^ s;q%QWDD"y6cqK>Y #;0cixJzD"Cn%*$nJ y&$SVbqu =$g^/ |rYJ~B>iO>*)x 9l֞[#O-)UdS |r=IOܷG&ZSOx[`>0"A-4k#4}KM\4@@RC@'\ Zm j>l{'8LdLWT^z/-`^jb) ݠ0#:f|X*ٙSc^zϝz:?KlF韼=H@Uuu3]ӒJe%)\a$wI1Ma-H`@[}!e7L*ELv"Tm,J.tڑ9o<;_FJF"1bFDꋮe&;X t*Z{QD<+p/ٌ h Y<rInMN5 ]L4rh39i-3i:3NjV+V5Q(DV/LC22ܧ)ΐl{īpyC~Da͑'f-Fvk" Co4G]#u7'HbìW[DKR en4IGmhZuvܭR)kO\ݹ~_-m1kCkkv8`NR)sXh?f[/NmR٘=[ K禦h)"cى p$LoE]yޫ]0.j%= ljg#\R(seJA }ըX蓛IpbA$ݮ4h>`fX? Y9l](fB\D`}߶$0Ym,^T{Xκ ;'d1 6em,uWR4ֹՖwAtÓI wBj抨IH@q$pSiy,)$n;MDwp}2ZFDԏߒ-n\4N8"֩%% ߊv<~u:nS8ِKl3fC˻S\Lkߚ<4.[Ɩo™7;B}ԝ}3!"1 w:G>cR[ۦcu:M;sm0zU{W|O|' bR:5 u>'kHqdʔIwpy 0lуf"`@ֵ 'V^}C@ j墥^VL*ˑ٠BD(JBe In9 cE<n*MVV 5Ů i`c+yx 9lֱoЏ{&ZSOʷΝ8n bRg!-Ivlo!')qQlY0H$ "`|yCMZ-5jT1~^&2T&WDEHX,9=M%@l8 .qލIZ8y BTFZ-0dHS*mexAcØ `C='ZJ~B>|iO>*+:wS.=I%-$$Gi0 fZ 0i 5jթR|NqxP]>fe eݍ:ӳV:.i.7V7yIةͪ>R蛕ɉDĘ0C='ZԔ~| 2ҟ5W}_US |r=IOܷG&ZSOxC='ZzoЏ>UO.{𰿉˲ƴ%?ߡi>%⽽ڶ5>[#^ɖ] ύiJ~B>2ҟ5W}_K=>'-Ԕ~| e>jl--y&mwKsȑdK < C:t*I j ]z`p-"F h$Ge:F :kG4 8qW2^ .g9aWrawL9ϡJ ے{Zd9u/^6w;=jLeGL5L] ύj[#S~LUWormv]dųmb‚#aM(JGx*KN{/wyP9ĒIq'I8Q}EMی^e- IRT6)P;*͎.aZU`єA'^ӟw=P*WwB!A%bZo`J1M9-$!з@#}^*Ml  w@zkO!om5zoЏN2ҟ5W}_UUȵZmV+tK=i -njci)BG>Ts007/wyP9Ē\I̒q%QT*%4M)2>Ʋ,3rsC)R\PHR@m=l.-s0$6; i3uɁ08 w* At3/|N[>5zoЏM2ҟ5W}_K\UbD,֛{ax6;Hi$sI.'=ssr+}g sI.q%Ĝ'U'p\ݼQSzƞ.lZso+yb$LlS4~X_NMǹt0>] ύjRS-/OJ|_~V^q>m89kE>a!9u`90BFm¤ɀM$$ēx}k[w^ q%P^(DV^RgN &dَ:(n8F*RI$O:& h#[ >˴MpZ ;%[t{At3/|N[>5oЏ_e>jl{At3/|N[>5)J|_~/FskK %Im9Yhm'@2#Aȫ]نpiAWW[rZ DD"9vhw%ٹV.˳DDGX $GQȕ1oRtF"0`j[>IX@m <تh\ik;Th- 崒<Đy{mϻWs u# %/3Z $8Fd z6A uHⵍ'^墵GܗN9*UԫVDJ"/鞛s}ew&xÜJ\ˊ Z'XeIqh'R~cgs֫MT{0\ /<4Ch  ύj1C@##Tϓ)Ue[]VmiM$!@ JR@YL*/QSU.|Dn B$F}C:!@"Ԥڂ`@##==RJN-sL4!g_|kXIOܷGߓ-)Ue[=>'-Ԕ~| e>jlן"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD".u;@q^4 2OK lHJJPWaEZ}GlՉ0Gһ[vxt5`< KHxo\AP7`yޱfjʔs*l9öi|yRwk]`F>cHSlmFm3Ry*/EUVr;(̊FƯ/Nx%_%S*dOO+`\nJ"Q\DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"П"RQ(DJ"%DD"ܮ֫4~\ZM1o~HmRq8bM7Z ;о+NQߝuEl}k;w-]U(DJ"%DD"Q(DJ"%DD"Q(DJ"%DEN-7,8o7\%CqXa8N5(ZrD"] ύk)e>jlxQ>?)ͪJOԒHة#b{Jc[qD M荓Wm6_թRcdwP^­^j%L.dĊڝymj ܒvBc̪&ZII0=1-Kf!JAYCn( 'mi8 c1 &pֳ>~Ak5aJ"%DD"]oVktKݡYiN} RA;$|&NCT0I'qiY/9&xz˝ܔ!nUĂ'#11dAeR70p "JUbQ(DJ"%DD"Q(D^r^a[?)B%HA"tv8BKJp+u s_މ厭V 'mǂ-G6i#l~AjV, Q(DJ"%DEϸ@Dz}t{ldu HHZR7$gT*0DbU2W\NmmWYƘíFWB6I;Uah He:y }K;n _^]_$VLx˥3Xm% v@\i8 c1+4y­k3w-־bCn_/P,ͺvBIj8Qꓽc`Ie[J`$*1,6Nq*Hz]Cv2+D5yzN˦z/EnoZ.* Ɇee )PKI;(y&Բٍ13 s۬ӗ4?N]s;gsoymY=:;BXДݽ7!w;G rwdҤj4XvC嵻pֵ%UFҨ 2;ˈԮ5Md9iK4n-҅- I%)#FE xIl ӴpnV11f6/$hơo]+ҜF=+~&=9>$Ft!\DvUXf}J5Qp0svyu 818g1ID6PyL߶%9vʶֱ:M0')4-a|&XOd+mؘmcARP꒔)= \*l@5ܓtIu"L"$(h9אzkq\nѲԦ%ّe[J-j!r@'dEb cR1r@RhxZo0 18x`YƲ."$Tc6a 7P}(9 g̎jL{5bg1P*JKuef0n kǵ)PuN{>dje3>qWhgt,13 A;DV%( d] c#}K-{pv푶܊2Cu\r+='dB<!ʟ],'/0R W CyYQs.ז[cRJʄ"'=sE-6Wuʂb^uwO,˦@Ym.+PHWHJYI!c$v,][I 5='g+>u 3 eʮd#6ә-56poAP:,[\gf6BK}rADN1ޮ1>yD,Z1_-C W~Ooy<JwmA۷XX/ј:Q፼s'VY,m)UY.r3z{ -27S-qqR.ˇ2h@nHqTTI15" /7ܜcW\ZJke3- Ra.'VW`=q;}[4wA19FvӬk|E'C]YC0)T^aIPU\/$ȐI Z2yWЮ+Rh{ $` Uk?(黴@Bt!! PJO&ܜ|&6tf-,/`ɂp@a,VJ1NSW:5gQ\ dy[to>HER;$s5V ?m ڏ 5[i;y uKu?F8Ļ8GېJ^ß5w1(q<{Uh\iq!S˧].srS) G0j^lf39JHr'oGEV"[y{ Q`oW&Y vSA8Vo6jtLF~mpQۖj%  ' ͟Vt>אKS 0-N@OzԢ49`epW ʱ̪3[ +6Z9)$7qΨNfc5}+C*wբf; (_ӤdVE~{cI:Nܷڔܠ0h$cP* 0pO}F5et:\Y .`nPl.^mVTD̩Vf}y\]:xqo(\+ ,'%#۝6 q_D_ X/ֶ8̱lmz]2/vm_F&V3.)oҰʙWKږ ߅HߵM-TM> A0"0WXa:cXU"cb:1aѨ9\}][]mRLuRT’{ թyVvQ3z[CF;r:F@qed\771/>:?~-ݪ*Fo7(&d  ' ^N Dq v)wb9;dk1葭Z[ا(bX_FT<\rPҙ2W)QuN{jLa'Uq6gн$/WXb&K .x7qmXYmpg1=!BI ւN$r5I + sx7'mۇo7}YAWPQm[ vz|142_#Ib'鱊%('bR vwEbOa00?YUm@KL$'/=w8p3 pV}^Wq~Tې8+$q)\n^mѴޖ;sxIubXM#̷;v.5/Aq zL'KÃllvve*4 P69 .ok7Uk. j#ZT-6JZ|Hۃͫ譯W$m&_~zJR$*4Syϸ$jV;/7<X/Xݣ}#i-ݺThm0s ڭf8raVhm/1"u$SmZVh25g^uMq]2BM 6)ql4PAGvS~9R0]GEWi#<ϙ\3\Ƹ[5: BIRIQ-0p*U[P^iAdTVWk}QtRd a9u6ahe38AkҡEd*3x.`g)*JIsv=+#h0+k:kMGW"O[r{c&`HmEJHW,';*b!Y.hɣj4xBnŦ69rʣmO 8ڜiq$5uŤ`˥cS.-3Uhi#nyJ[#1v[Ѿ¸JNI"U)rv>1C2uթ+_܃M쨡á=ۥųҾԤARVڱٟ04ճƒ@&dj |$qu t{q`PՊq rO8K@IT{=qI o b,?%]r;-߯lBfy EC!j Ĥu#D5%mcu7gpZOn0,֨}b[-K+M1)rJZOX'a ĵ@uqr9 ̕ѣ+Q =`$l'jxi汦L.}ĴA.pw6NhUicZ$D Mv^ :mZ-pg񌖉JVv\fN㽽de2@Ukvk^ h/57!z{.sVw= z߉O4J w=7Wa/?']uN̏ǝBg}3uGZfW3fr .GBbgmm<-9l .k?Xl\',vl EFֳj6'x=D[8 >n'.>4۱Չ3'V,)bc̱-+ĥ'_$o4u׸k K^d>GR#2#ԪE ]?U⭍iʏ|,8POK!a Q;v&]tf|5N R'`:Ǖ% n"R#mѶ0H Mg41|~f):Xj{-86809V]I²+5 ޺яnOХ Txe V~^LL2z2Da̐3GaI8 3"89Ĺ0q{e%Ch>:K-3;6H3EYNM0NG!mz>;r'jr]]B"{r8=i-$&Xq'p{fOzLamY+m($\ V3UZ&LBNʫ亅bZ)!֗n$̬M˩Thhq8>X:Si=^|еILfsq]I*3c};}3ήzރ)U50CWFԍ#_a>E[n6**h>{e75b;LG*hg=V+12hoe7qfXuhs $|^uTqw":WIA68+Ŷy4 ]|_6\ZD-7ǣ8s ' ]eZ"c<4gNpY$:,_UhbLO;,lޭyΦJ f }!a-4Z)HbxF.V$myaRm֧$Agf&6&&-\>$$q9ɍyⳟU۳۱G4-8U+жʳܰ&0Ѱ|ݮQyC<4-)֞~>;[iٳNlt/&CN@@3eΦM=RY1 ɐC!A\.,;ET ƚRs!%J+UFTTﻆs'd`Yimy\;v@َ248Nph&`ӋC4Tq$JmJ-! Nn# "#sny*u Cu첌#lkWwVk^d8f'\=StmOD!/%;TBU#53H6iXA#A@u j='Rv';zV+iik_NiESr=G 7)oJqFã:iS8n4 a N@vHY4֙e 3Dl^ӊ8J2.oBCKgsą}G*L9x֫oz[۶`ZQ^$$H+kvZtbj6dw,Sq +bm p}CEZKAx~KX&Đ|̱M*Xuuv,yo\*DVBqEJWFT$󫴏D:h ppjQ$*w5bu͸1TT~}8ʾ+̯ ^nm29G:ò ',F5~-oo[$+\_J8$[ 'GoM@1x,FZ嚛ZCd8c4-%vŷ59ѫS66!f8հjܰuxAȮ96۫L芼A$r*ʊWۓ;+巅ؾE}im2IҔ|5 $vyzTZZkPR @Q^1)Y,ިv#I yMB)$IZ7T ~I;h acl;YVƭK24 êjVk)k@ѩq_>erÎC禱n {HmԵ5CbSj'+nI#unsj)q8F  ܞ`#9ɜ{5W4$:uaԲV04jFYsl s #)JQ#7RI(6J8`;memvvb렃p'`+LzPٟuv;g*ʳNa6]mN1(6e )N۝^Su勝C];ɼ/q,V:Z>9DDj,ؙ`o¶nseR)T %)hn"ўX=,i6p6=o0g֤شP۳<=bj.pKM_pf!ǛߚO<"v̝YnXuǩqն,ٌ"&A"CLQ=V]&4&Lo4q>yu#=0Oڑ3 $kT[,:0hZ[8Y~trEiҫ'KpE tpV@Z0;:nu.8kqq#u՘2dɤ/Mo[j`rLNҵxT jB]F ZFO{HHq(=Z {jo~,N<$]uǁie[\^ur׌\͎Etg#t#vjJ J+~UK K=ggy-Ǥ۩uv7_)FVZa'!d6`IZu+ϣ}% wt]^p`:/]VSQKZ'UF|J-PɺF@aj-9%}Ƿ<C]AAEm#n ?H6*8p<ѵ :u^3Ll0TRuZI^A4qCrW#BC4lTT˷\kCs ~x1y-DUsi7q;r |ZkMVXӦ` X;UZWId☶[zCzӜ%!Gc[rk nO KY\jЇ6im i [+Rx̍Bڄy vuӲޚs[zcpyp)2-"ڃWl!%]ccH OS\X-E711u]{Xk:dYa~K@Cy: s,Z$ÞGB4m.pzg\my-$kY JRQ'W$ h$^:) smaWC>LKsV̦:RN>CަYR Nq8L@^MQw(Ę8 $zDF9҃-cK6pƩӼ]ggnŸDyl\lj !ձ|i>ޗA8dL Ң K9$Nb`߈gh*C] Hȑ}U^/y6[Խ+LMyw:6K~5Ǽ\v6-֜ԥZ/+=>R Ń K V|nCIF%JZ5Ȝyy+̮ƞjHSJڸ y4&?(kдyuv)1-lK:qQy) s1JW [MΫ]ܓxE>I9f <@^c^9:>ęU8pu?Iُ15?d48kҰ/j/蠟ٷqũy6;MԸ!رIDZ9Ţ5±6/9Èc(8G},>:ی甭Է3 E׎=u]9l5f߮1kxKx;*o-zZ{PgYY4dž,j75'f\$ 8bpu,-# ue3+Ƞ2g>>ei(%ۀog:aV}iX>b:[]v⧭IiF v̭h5Trbm'6qc5}hsO# U.uGw s›q#n Q9Aqe*CN3v@4N~ UMsbp\ĈА(e !+l,Fr]q ̂IF^*48>xGjU:f@̀u[ɓ-Y+\{u e-) gnUnwiܩu杒 h>q<$dUY{@>8L[l]O;I_hd0=m]I (GcT{ MWE<է$ì@< ͦ[ܪwQTssF劻Y`hOO:֮Fŭjųć)[iwew|8uSZַl> se1h6]6Ӌa!hnkqЂ29niapW 8'Ͱ,vA'T&.o9ߨ%>þ~r)%ÄR-8;֙}21ѵWܪ;mԵ$k&fM_Awd>GR#2#ԪE ]?U⭍i<:oRR%1eJ!CmHz>zho347H8(/MW]{$a=+诔޲~ Kͥ}mPzt~$TWi gzE|J>y7:*UOΧVM5?Q=5_Y^OoWh։Eep_"[P6{{:"Jҩ ImH'kγ\B'׫)WԻiCfCAƭq$ahJVOp! $Ա9N52i}%7Y2H# WGFyٰժטͬc4}UݐS;%#[%/^[.'!5Ƒ&2mHP" Ϊ8P'{9/\GJXf3dk$msNT- {cb9&JkA>g+K e=c 1d_8AA>^g%,`^-Ca8/Hy}-"\救mYj_o\LS\!;q,:}SaʃwDdS4 9Y}]s%4"[*HWVZpӫ8? )c E{lVE>fg nG;m\Sҋ\fOiR\y!d;W[z&{FGӞ~TtWSc-UN2s+eJKq4,6@s;l)47#;Sx ;Iq cI1svҕlm:F9jmi.$2=Ƶ-MqJVJFRH'r'teC]9bk|D,Vg"DϹ*M6R*Czީ]}bxx:{um -;j7cY5[5*^>v*?bUdi۬JTHpU6PRDq; l^].0˾ =ӟ"RQ(DJ"%DD"݅WOįGAw샾woڷF{~VFQ]5dWOכKۯ5 Y5l{Tv=FZ9 ^Vlp򜘦CŮAJI\wd+8T4m3jxUR?p D᨞ 4zBHٻWP^;:;cYk x^A›)'ny6ܯ <ղ̨DFљ.RvMWR޺n{o,עe7mf&aFCs 2knq6*Zq)Frwd 3@c/vu3cО_A>1۳޴aծ\+ϱ뼳ճ˿߷77\k[zm{o.jl˼ 57H X< 7;w)8m\fI6;Es'PhDL(NJg=$A8voਚzp[+ vA޷I.ԲGʭ^+kgݑx7,̳鯸Kڂۭճ7<Į c6ÁxPpk;|וf)8|Twkv|T#DD} N%/ĨԽ+LMSԯGM估豫>׳cwH꜉ Zݺp&':6T-;g8tt)oKYsFӞ&Krڂ<$);~eA5{K]91'i=Δ? /i[zO>c͂ļ3-t y|]۬>ǴdkQqR1:Ĉį,]UmjiJX%(yinm ʎlt[f<7:8k>252N:!iSuȉ'8UG سGr&"[ӕLFrmVw'A’[*=$-@oʬ$TAϤ懱8^ DįGE[MT<~2LE]q"?!RZbb܄/ BR@w"ZēY=ZF7`YO"$2/Y,-ڳX|܎T9+ҽՇA+"$:lǤ-铏Εl4%!(0;u(eF5n`^# /60$WN^ : 6#ω=ܷdD}GӨXj|} ֏<ڿLx3|wu* Hd>GR#2#ԪE ]?U⭍ipK v=k6ɑ!c  JPyooF;͜ dưp -fK\7I3)5C1C ox/lPm.:G ChSh R'nJ,Y)&4e[,:&i8纻ẄvzuBw ^u/o|ǛWo]_A™rW<wDz_ѨX}+[/ޝLobQ_}ζ,S]Kx >ұtLz眯i0ѱ<$RZhM=Ѻ$)AA+6'!ؒ`$DŽD*Y\I0Z{GH;x+VH 25+[3$AX@h̸}-t6 ;nG2d7d R2TU4 ]$y cg@.s6#$;5 _> Yo&:BևzW K)|<$ǐ޳Zv0HI33P얏S^y ldve3_4=:6ԺP݆ x.[]HK<;A]j` .6>\Z^ ܩ!] 2u˝gT;rw)HQSNtjZvb7mtk b_13LVsP 'a #46OS#^wcpڿp :Fn0$.c!CH;e&6XC#rd4MRN3;W,mIZ#65S.%n-[WPeRƁަi {776yCL &#u.C 1;NqZi3UJĤ"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q|w F SjÏAqKi*m fqkINRo8bHbDX8cjl0KrinM%H>Iʽ{)mCn`Lp;cj׭l}- 94 y㥭tYE N` 1'1{MJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(6n7m0-ns1:([/[ W h QNõά0q'xJ=@C\L L}ϲ"DR!ԤtWlx,h[-IͪD25'M쎳*Vtb#3dy^Q(DJ"%DD"Q(DJ"%DD"Q(DJ"/՟"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"֟"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"ן"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"П"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"џ"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"ҟ"RQ(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"Q(DJ"%DD"ӟ"RQ(DJ"%DD"QZ01wi? 6( t٘8Ícb;ʨ瘉߆!"13z[5jTg+wH^fǪZ_#iRcX&rU3mn4񼉬ֺb\IHnhÄ;KlmuٍXaD*^p1v3&V,v'\qn*TC@ [$vk-cN; Ke{ 78yA9&~Z7 l:&B]v#u!>+}I g"13!I `L80;YufqTg>ժ(DJ"%.Sbɛ)}h-WW IR  c 2aer\+՞O^[.-[|h܍\J92#`Y[yD$}Je-v`xTUbQ(DJ"%},vszɻmOF$ٴ/m흀WSi{ 'bU^)4I;LcPW*z[6]r6c>dqP$u X}KVQp->ձD1DZᰨ)pG®-ܤ(D٢"Z\"m:&%ڸۍ+%ҽ:'4툱̇0H=}ˏ[wW%%=%%0"8 }]aTSGnʬ" g^ƸĬ c_'/X`s૮ڕבSsXZu'd⯼o s2#TtL5Dcjժ(DJ"%DD"Q*PHlDnNshnث1Uq.p#@FbZ 4ȁF>cժbQ([ %uZۭDxT7RP(;VgH[/pks$vی; \@0ܘm:+a* V`A QQȫXD_ U 3l{':y09@8j`9^g.ˮV OlP،LlV\Bd8Ky (6Ns+eSJxԦv8yeD9q=qj!GJ"%DD"X6]rɮy)Fe^)Ke J*q`l<ʹM~^QSKSYHIHD04l#WRt"Q(DJ"% pĸY#1K@:%w$O1U]xj[-o4DݳZi gaĢ":m\<-gdnN­{q <洸֋7(xnun!މcx8JUo6פN p:gf*UZH9^󁗟 Y.T7`99fLWv4wdI4:sYcv8z'4$ 0uְdD"Q(DJ"%DD"Q(DJ"%DEԟ"RQ(DJ"%DD"QP2q|\a]FӼSԤXu3z¨[6|;S4Ocay}딭!d8CDuldu f}[xUJlf[wt g NyBѴ;#wR.2 $n*WcXuB ľKA1e{^QylZe]wxպ W'Aijg#um-vɕK+1@; S,^{ڦ|x}ј!vuǓVkR%Lv+ B63Z"m`q|Fx7v&s\ϓ#=Zקm7YN#.px~:VMeɤyqGLq[QBд%@#pEx֧BS,qa˜ҘzOMf7V2` }IJv+Z-u 4\Axb"3Վxz64s/D98a/l֦k͠9HgV-LښȮ]׏[.hpE&Uɠv|E(@w|,“ڥ IxK t.^5u;0Q(TmZK@F8 sV>}XMٰn"tDHGFܸp6kזylRNWyxaNFw 4:MaCI#^ 経~lmVͤK6)/ɴ_^qhĺˎz2%[DmIΆplbk1kb 32܈ڪ=N #TKOd$dz;>MʺL5inr@oosz,%C`n%m521I1ˀ S1xPt&wCvaB9w-V451f'8_}ڲ,nU.2{|]QPCʸm@ ZIkݺ3 n:{p;EFYHM2I Ff 5̯YԻ{ŷcy/* -N8;'O vyaC(yR.vrw Xʹ1+TZ.,-\kϴk9-hI2L `IU)Ra`r.-kۍVR-$A yGΗļؚU 6JNibQ#j=UmL9cwC1bGQRt6 C+ =|!OZYX8Mh."#^kܩsKQ;nŋq݈y.Em JZGƤvymeV\4i/׀Sm s.UI/ #&jg~sVեzZZZ92$cx9edy} ]RÇc˹Qܚ-#yZ<޵Ti Ajl%eV !Uzdce"ysqpcn\Ws*"K8AN=؝U]$cffiU948ÆA{nR(V+Lje-ule-I$ m+2(*m$NjM=ݲM،^23tdUւSU-q7Dld n2`UlF@m"@2Y煋rݝdwZXI  9 BJQ} [2 3y\^]vCu<3_ڔ꒔(V`>.:Rhԯw./dLv%6v tD!M2Z<¨^[,ɢ7a$[=c츅lCL#Z7- <ݘjis^\Hpijێ@u[=)Um&11Wێ!\W3[23[\V="$>1l6FBJY-LmZ{>رČNaV=Ů$a}-7NӼ8a-Vf~+cnQj_C,0e)Pv(鱲qq%N0;ܳVִeRks}v %Y,q.ϐZ| ēL;[s k0ݻ6ıd)E&D{u]7 P>'`;dX^QFu_"˃䴼uMۼLZl{ٍ9sfDa{޺uK^t!=%=R}qz?H c"ٜZShû'`c,qˠ`-tT-y)H"ow8z ~Wԋ7oP^"KK꤈ɉ5xLd8 [GIN&jA![AǓJb 6z/ ̒2O~Wȴ(˙"r-WXwPk뀑:P£ 7pVBPсΣĸ \|Db5+^2@wC Nmjnۀ[ iIdTC*\,fVBCM$d~uL16x^$9/0LF`lv9N jevq7  m$1P#@ԲF18A#Q: ^Er,s{G4GF?uieFl` 1'l~4wS!d*H<^HT%cV^}Z|,b,KԎlϖ\aBb4рi)HؑV(RxRHk23:VUiu0Dq ubHL\ ͠㞹Pslai2vVCyιGO eS  /lvH6F`epGRLvl9v͌n.icQ+M]zK ;Ȣ۵?nJJ Qz4$) svaL $_x"]JMG8q7P2f0hō$`Z$23U>s0i*vCix JR [$cH,I $=fjbKRbC˕M@;ӋNge^rRsKQﲯwcjaȳۺ;8Rw;D w罤 źF#l>XsJia9_UZYX8Mh."#^k, T0;ZKQ;n{W.Υƛv#%)hR;\<@j 1sO>'^M1̹V$4C"u[ViihȐCg!jȲǴ v&Sru*\: mpHvQ mڪX釾:qCZgyqVWZQ5H#cekX8I2aKq ˊOoѷG$IcV,hHexm}y< -5ֵ9~.q@fJf>.#ĢLiJ~i;9 .X[wÎ9VCp Gز,m{{# L,4R$^:9u "BRyve6Zv31֖6q8FH#\O:kZѨoyՐyYy#S$ImXCNV }}yh]Ȓ'c 殭RW4޺vZi ;o<ߎyeNo2pHߜ`5LZZ.)%<|<@l>\57" HyLsbX^32 $DZ͡c֙kDjS%˰du<uRUmx.m\Z0m8Wq}cD k #2^ P^k6.Hb#,ؼ%0#ijӲO1MXGZ9>(єO0yV+j1$f#%ϱҲNϴܣ2piǘƸ*$ۘԽ&DOf-賢=Х%'Jh A7$js9_Zs8NqRYbm!pm0\ӻX< )KSe4 ˕RƵAd )lVK rA#p>hY1{ %6a[:ՓurOFw+fwk8I;%KeR*!0ִ r^L;RId`2՞s*,>Rov${Ze­ۜn[]܎eF'}Wh.al淽` : @9Ô/{Pq-83TN8$ đ'feP1e7X?NwL;KSХ<% ޭIE˱p;pNԃKsIwz@ip-߇U*58Y5G YaNWسڣĿ^sm!6Pʠ%*Yj^ 0Ę1$jayql@nH~ kͫmeMlc 2ܼ#ܲVR[dGCdq1]rABHq)E l8噎Dua>ܖǴܞُВ3<^M;%͌"3($4w^$̵2#s2 F$R{_7o= @ܫz{޵Jm+ fu >贞KNs )Qߙ؊L5>nϵhdwUXxsa%# %bn7 Bٔ歞YDn5 3MOIn{Gq ؇BelG-=(ަ D̂|gv`aK8DÃLHVrٲJi7!$u =r|O3qxc!KZ_D! @8J+V1!h'mu:as;a8gRk)d㨉,3do{+$j͆IaȒ}(f\B_R 6' +5'ef4ƐqZ2F@{󚥥j m4 SdFZt/{]U)d7ktYR\%'%CѨN? zu:odEQlwfVֺhHxTlYujs#Z"%VpWHi w3 ;_y0'1J]Yu Q&7V̌sK)6XCIf%luHĪm6t7l ݓuwp#ĴJr9N=Q}{.z խ5b`a:O*Rd3shui +dfkqm81`5pSvҎP *Խ(`$Nb6`P<8c$kj Xs yQ׽]%;jf رkT]'M5w=(.PPbHog:s臹ٸ <@Q*]k cڼI~1[ae 녞Eɶed7T[w=Cxֺp#-Ѫi!*bykB{!םg]yt|\a~/]/Y@#)lmEѴ}J]7F*G^$+^4׳\|pn9tǵŶ; +lV~ə+?_ݣމ>&%=[0 )\V:¸1zep(pNcfj/5úUmMvy9b kVѳ\m6{w=2X^HlLxalھd^IsiʬVIOntxjSջ%-Kpyk+5P" [#Lv@&b~>RNRHo9&8t&k|Wkk'7j.qj`oeZ{D4aw{?c -Xz^\f涬A"FGk\{tPw}~{ۡz8xؔ*71.Zc 9XU]{]?cJaǷGo6Uߴ Dd蝳^w4ϳ~&2^}Vnvioy;'־5]k^3mtoX?M}эou߱JO47({]Ԩڰͥbd=ц\-ܩZt[hHNq *fi8Ihp@ﺷF H μ3'Yڜ3@&.%Lῂyeُ:evk[6Rmˈd]2c> \`y+3q$`H1n{0IX(X*av gyc))_sSI$#]hGiwrIdS .ߋH@:#6䀯U0L '9x\{ހQkm,Z.۸wd[/֫`+tYapPgt۶I&Q1tFfL}咍76o:8`ouıF$J}5ن3boDlbb#'`hK3Ж=x0ZݹsΥ*heFIӌlᰮћuN^3u* Md~7JA;yޯuX!s{p%X4]5G>0X͵.v38̯Ղl\ ;{՛ny&6l?%)kIe\ڭ5 nUHՎbAگZi9aYl<~@,+Ѳ ux$정@Q^ÜJ{]8 2Jc !X뾉nF'uՉ,6귲ZZJzhu.H)q);+sTv*QߎoPd,oskdN#;@z>10%.8D&3㪰¹/zoϰչ±6Uj'Tq*{tN/.2L`>8TKKi>2Lnc@9s)s9 ݭnf VnbK{2KaoDXx1rD^46@$=F)cMm(IJRBK.|$yFpy|8&|0"Am-M-Y"iFZq4=|P'f0uqB(=)i0PSV{[ꥮm L̐ZI)VH2 :é42#+jj6:39Y c\CH8a8϶$a9dFlps)`qĂ0@a:d,v; qq--߄NՖGSk3'Pg-N%cB!.lK%Hۮ)+i{+m{癭4[DXu5ZipzwQ^kM&@u0qo8{ABQmsOi.*T%w;-8l%ED;*;ˀ GW>s(ӹ8\q$ӔZͬӉ|n jU\s"[2KA#- .37(B\S/J\N'`yN,&2p5;)5 I-#0Hc3[-S佷LđF^Pi;ʟȲ̶[i8%)@;uWˌEI%zuV鹵WŢ8/c4$''vKid0SCaVu[qt}*aV~-ˢvϱGyDR勤+w78}K}[pf>Y>𘹪^zgHߍVUt^CrmJ ,Z|looƬ^Dzgg{:=j=n;]OVkⰟ]yv]{rTþc[˸OJ. -r܄ta뚥C,tPhHߵʱ!H{c'5O44♏VSvn;"~ҜdA2n-Hyo&㩚7 v]"͏1zϓamb5y.#?Ql=KIuBs 4V"V!c.{ӔNÛ9oi{yu#c+ߣD7̟,{rc+ZSK m#Ġ#n{{c 32frB.ڎtpqCCm"u>Yݩ}m4-+@bY[޲ i%Ia ^w̵ʦر̚\󳾌²L8+<)wTE64:kYjQ&tixDgFg9dU99@.@;Nt$ʹReV+$ƧƷv:<5)ݒԥwqiwHcbV.7]$mv)S $A7:p_4n#?[Q ;S@ ./'yceW0SN ̍rݬHR@8Խ錈؃ @"ZZr 5<##^C#"ŲlQed.\hmmp.$!^+u,ͨ֒C{斜g>:F:ʍV s{038V8Wշ0cCY'g ҬGXZ+t,F/%IޭeL_@:z ytA;`*Lt@u7q'^8`eöɺ˾HΚZԥ 6Uxq# nyuUi$N'y=f#py[Κ\?qp|NqIVwRRuϽ$Ep$ `Lz7 :"F25){k &1-"LČyynݮ-;qUSl8Hiƚm-8yH9 P0D4LNSб9{Kj0 d6+hX \ \2 di4 1r4lɆvnBJi,)i+xTI$v^ <g`o.M--mIpjCipId |)ʬ3em6-w* 7p* r$:"7V:Zz '/%_VNL˯:1vbz7/qgf;%]8 =AƐ~|{muF)lg%#gm6Lj<jGltΞa^X%^t7Cm mߟz:- Jtny|lo5[M~4y OW~BqN!A`"BODwJW1嵔XLd葪F1%f'V+-.홂H #-`*3uδݭTq{ F 3 Jy4Rێ$w吖%LI@nj'Tq*{tN/.2L`>8^Ǧ7uυli8A? IepV~WǮcf$Z6g֜wwn+VYG,6;'^W}muZ:EqqoSXo|Qꎟ9)5{ZR[ܶ8/#c·ᇮ|(^gݷNy!\<^;os* icїJZ~=v+ϧfk\ckFyErXZvc7]}׃ߍ!="۷Ke|c9,ΫLFˀ̰֭|4{I>9}Ƌ^`%s6!!6.%ז%_ YYX˹;@8p~8F7CBOW 0ii A7Kn63\ia+. 8N̓ΎsM79g B^ǹXrb e+{`}1L44k9T4Zaq mzËKI8O cZ`0 ձ\(a[ #Y+3s8:\oQ锹W;vEe1 %dFnSM Nݮ{ CFW)3c,aShhvلvV[[X.h{f@YFLsF'-y,8 LtzIShn2BRv $/kZ!u̓2d~k%*$9yK#8S,k7&<㴕3<v=c[ gOt'Y88:V߷ۼjm&8XG6iΘewO:g܉128"zU#pG|Tw6D)8^ĤbS%[VB5kR(~~e_Z*00ho^ycNoz|aװ/4jTju:ͮuO[[w6ۇ՘V! ?ԥ):3"&'8'.%N` `>fr{'R7..\##{@ݨ3R= mҔ y8U8CyvRVhnuưv|qX,]́%ʅ?Ds2DD5r+;Q=hmC Bo2Ҵ oZ!_$2Ĕe.s>stream Adobed              E$     {!AQ "1SWaq #2CRb$%&'()*3456789:BDEFGHIJTUVXYZcdefghijrstuvwxyz s!1QAa"2SqBRTc #3br $%&'()*456789:CDEFGHIJUVWXYZdefghijstuvwxyz?@@̈@=֪d鞟hM(̓R/|mel~KF걇kc Θխ⵭ʙUWv> D92XvZ2Bf'hTN܇cݘ(^koγgd{pxdӣ@h(ȳ$Q ~dʼn@&x쉚<IAƏԦ['ό%a,H(δrZm!^He$dl6ҫBvuFF˝ShdJ<+ƕxrͲM7%&[dG^D;) E2sRtXv_:J;i*TB#SÂv⾾C[>46N4Q%K2*ȷJ Fz7lڮr7J]yXsZvA! bwsIj6xw+UY;Zۥa{X15(̵W"stJ񨪊\霑O/^ࣩJ۝h۶qh:mُS^|NqvvG H:iѠ~J|lPۏԺJe/L%iVKbFmY)TRN|cޛ. ^cݙl HǹLlwՎrgjT50 \M)vhffmjRZ9 ěEqJk،iL ^KkX&Muby%UޜSfz%pEb gm2rF4dEHx0UםOcxLf!6>•"͠*5r6τfe v҄kTFĥ3PLsUHqOpRCEno<_=d{I%9܉Aojvɢyox&v^CGDJ4&,=LԳR3C2l*h_ n{ѺTw8<ÖFN2L"ǽۦmTk޴6kʎ6:P{ bV"+ֹjF2"fK<&2}H={+۽NIﳕjɣ뛤U-1c-&fKfvo^Y ɊX̜ș2c li%NJ%Ҹb^) V`CcQ;W&d_WJmtK$cOlJ1jV`kԖK٪(\!*Eo)ѠǘYb.Uռjd^vi[^An5HF9LrW-+Z)- ,jI%aT-1[K򼭽k<&4l|+n8A@}AF-j IN;$`Չkd%cSA"Hh?#v>¶sYkݘƣQɕbWhNEeH3SF5W^dhQ mYϑʝIU÷Yj w^kQvlZtߗtoT7:KnRXO=;Du|2jHY}*!p%,b*pr\TBe򼭻 ^Vp El|+n8g¢6>WzaQD+۽NY0 mާTQS$OD\Dƴ%RN/|Ȼi4.Z333DBVĥOL(!&WnQnPDDr{j趮m;6g1jv<ƩlU;Kt[RmT UL.sUU+Z&}6RӰ/Q[ZsU(SJ-+sW[EoDT]FSMQhC-]JNKE< Y;:<+1ס.Τ⽸5Zu{2QI+f#CMnsx֩G.%j*U4f,]ԆĻbb\NVW.*Uͭ6!q9#ݰ!3Q9ǀED\â5cՎ;eMXqNQ|:P [3%.0E6bH'h<6ڛ]q1Z;*ĈÁ+fij mΪ뾩/we:ƭiZW=2Q3)7]7 ef/ھ%ٓЖgR"VYW|úmq p'=iٰg(w$z[ǵWW=0JpVϝ,j6ENm+(}%دM )3`;>/l/oB=J9s3QeDJj?rK_Hi)cZ/];'.U\UٴxLwu::!|+n8 BIJ3*Σh^ӣϘbcϧuMӓkEz\Ut!:ԗS^Mu:+*""*"]ʓ%1LQ7'(Q6jFNH/#fJ3ƳIh>VBYFJ.ֵ-jQ3%MB]2"m"&&G dɣvرf-,١ZIIh4sU\|faKtXFÜSe۝mfML:f;*IQ#L1^sd9DJ"SND"NՊh/by26+yzՃuc.I,qgd8oqWNCDt9ȯFt#jXnC։hC'b!“0J&y Mjz9ՑhOdd;[6Ӕ%4FZ9E.TECdY9PQQQ]̵:D{tl\ԡ|Z;5E='M#'ٟNG>wCO%S AsʿÚCJ|iv+qL<2>R]á9}rad!}!>}bypJ{&Ϥݝݚefk3lO16/PUypr+ Ê_p ĵj;w}q=gjXn&?,1_!vgpz?<>Oh7s[KGEHwY7rS^[}uKb}8i8 4]r :&|M_~9ׯg_q)`; afg ݁ehVX@P`vF10LX`ǧh(_vwGO1! &9Lz%Tt1%ҋ$ųŖ-&MRlxZ1dEUިI5"zx1K]ZU2Jyl5;+ hD\/9"ɐ|OCњj6.pUrQ2e )gZTEZ*4UU\F&C%j>a'JydIL1ѫ~,nEGnv^R8k[ʈ9VҴۦwTcL ٦z"*q**UE·-"[ ; "RLRߋ8N[%c]u\ؿ [ܚ%Nl)8J/f3*F'vXt$潩O~*U^pFjrKBõd7zCT[^u"N(K2A(6QdMug1XHKGGaF.eE̺P$hP-HLZ"/nݷȴY4ImݥM:IhL-Ҷ*4(Ul22:SER)y$6,y)?hC'֭1ԣн@mIZ%*W{#VGafV5|jia|K2V9iVga٢0VydU)Eqko!ݛLV\TFk)7oyRo!]tD1:XfyDed;;luFِUXMV5:ȨMZDˠYrr2TC+-b3a1**"sUhyzZhɼ:12qjZo Ib"*K.BVaz†(J숪ZFbtR1Ank*\_b%w%rR "(^nSS&C6fk^1FFDixӿQ*TqĮ"5I3iIIwj-[m͉؆&IxԩGET"ZeԪU-0Koi7N|y[NR<*"kHW6Tɷ|Sf E.&GhݭΫ%(RҴ-T22QV+k؎Ek&F Vb=Q98)C=~xND-w=VkZѣRffgY|iHpcL׹)2"faͫV2#1Q2%kD˘õ'Xkb6}~* +! ңԪ^2<7l.~#T땐܅PUmj/DؙTp ;RYRV(ʒ&XrYg.LP:0f:-z&g|CuF^kωDLNsUZUVVϽe%+5С5{iUDEZmW1d8l#5Uhg`DGh$GvOS-v Ж[$ BҤFFUX6FUHn{fsVvTϙHƩ_9 Qh  IyyիV1KZJRLγ1[-!-lDDDH"9hmճb|65UVJipA:d=!zTuJE;MMާى\APT+!N3Jz}6&G7zk*Qb|'_^%]hx| ,\ݙd:f6k= o-1b9~LrDZtX#ѵDȊӌnzѩU$~jd}%gWwbݫCdȘ;0`^PY*Xf,WV‡(jLu^5ֹpLQ2-Z*ui*mn<ʭ.V2ޱ z֫D%TjE84K2>[dz-Z=#ٳhWbδCEՏhEbLTo/"W9vʻHjMM2^]toE摰lLE*+F7\VPwɒ 617wwĹ]>;:d[M-FmYd*#21HV4xޭTshr+\冩EM9ϭuI+YTVL鉮jERF6ѽbVJJjʊ:ƘB *D%gZٓUfLЛǜǫɬ)S["QM DCj}wvL7+ͪIi:J*kcժ-%H7&:rKM[Ͳ&$X92֭(IyFֈȎcrM5D#虑G"i.j흽{-K&a`\u\+:"L6ozy}h%L6[rF*L,,yV3V+Y/k7Uu5Ƣ27i\*h'|YutUk]Wqv-h-jIJܝĤuyqə٫`݃t)VMY1!5DF%I2222+"ZrOjTTʊ2mց׵QuȩE䘛{Q͹TXTh)MدM3Cdd HuW^zR/#$}#Z/])>ٲ%%ޛǘbϧܱb4a)>?ݱl^-j2ynDfu3;WkxhvCEJ"Dr'"?S9X3WrHG9q\zgZd)Or* +! ңUmj/D (ؙTp ;jrې*JE#ʛNpPTVCrCU٨#bdySw6b?|'N qiVeYf(F!Pg'dkCCg`Xs4꬈HjZ0u Jҕ+E6ųUTTTS2L|cFw5U|9ʜgWvsn5aC5(ϭ%_ g&tv"O|*I $JgC?=6șj"&.TZ3"{t8ii7>1dseTLW5wf^ؑw*RM(ʏ Pt%͋%%9ɛu,mFiΪڽ0Ŋ쪹1: eٺ2RMcs9r-+D\5̊U(QG+J',)JI)"JRUDZD:Z1j"%!GwN4ՒMfuV;+1asdhJ"sWvoLTњ&iYuDZ-t'fZxt]Q] ؚ]ʢ@\D+'4fLHfDŦu$͑Zj3<蘱^HϖW*j^UW56γU(LKڍb)Dd]qVջP9xWr&8MH74#Rju.$-(0)%%MޣbI)h+IY FuOhݗnTl7vs̓ j =wᤤB!mVy9I%ʲ2+b2\DT+Ƀ8`${ʕxv~edKV49;6EiKlnu"q8Y0'm;Br2w ѐ։ŕQU9ʛ9Wu$.Jez.jҕLK|'Đi Zn533 ø^XQ{fؑ6>Ce*}CUR5wrUiXmr|D:ȹr:z_mBȋmU|\ Oو^a%i. tnWgnHjJ+UǵZE2]6٩XqkGbN.nv$4oSx\^Yw~3ڡZWN4DȺ]+UiXho&%V3R?ʘ̳φC/ ͳ/#A,I(w&̓jiZUfU|- b;2SZ% w,hRZ"Urcsbob҅%Ȑi}͂عUY)*ڴSEIC2J3Rq-kR$֪g"mvYd$^IUʼ\ҹ:rX x:)Jl(cBnKԾĒ#jbN4ْS4mww:Ïo^Ih)]e]\ȋ57Pfw6b`r;舊j^L n%x൪b-vѱT̹rsIqR)mZ-UmkQf(33ZP#tH*UUru.TMjfC`M۱biAJ33@IxԪc˴uہd1b9եU-S-wMB \D,5.2&.ٽFYd90[Lb ,Uhe.ѧ5IEU3mZf. q*UEZ)[:qm(ȩ0aEDXbTW'{?_Iiɇb*aw"Ȯw$fc-[:bR"MUK(ҊԇvhMWY87${p,FjkEE}:p7HĆբVQvmY-k21=̕TTTUE\3+i١F j#̓s[MiيzlYIJȏo9V2dJ-ndž֭V6]ۢ!muNˀ(\L~Y:<$Ջt%5IIQlȰam7CnG5h"nJoe N *=6~{D!-ޞ &ٻR`͙)$jQgQVvl;8H\ F7ZԪȉz;XWQ1*V7EW=UUsTSO_H)~^0|JCeymG"?N}~_}j?rG_Hi>9e-عɳ(0ɲɴڑ⾱ѰT.ͳO6#_!><܎LW9QF+u?"QbUs"qJd0O4xm,zi]fA$md`Net7eykw`-NޯA$md:[=6ZG|#bgS5{~In(fet7 'ؙT/7Jsu+Or]X@AIDJSFV(pOh7s[KGEHwY7rS^[}uKb}8i8 4]r :&|M_~9ׯg_q)`; afg帙%J2JR""YVff7THEXDо\7>œkR#""eUUDM*V= U 8Q|KSvѓYdo$ea.ގKTUJ*1Spe5Z@&:S\E̥ ؙTރHqC4:[=JvZG|#bgS5{~In(fet7 'ؙT ^FۊCųh eykw6&{;z%ٺSZ?JS<&hrdحZ%(YD-fUQ!ƴ,f!9DsUQ*)wa]9TT| i/GYJ\9$EiO/S#塞  ۤ5tպ viZFF.|#P#%n: Ri?߸Q<: '$d)=KQqmr%)L22^BՊ4=1- jErdϪvԳ=*.UD]ȩtmQT+bĖu&*'*-R-3B'z!`y{'&*yy6{DųxU(3ʼm^GK?=QNQ\DJ&t\}|YL= \\(aDDj\&\*]nb Jb+݂ۢŘ$KB#.dfI6lhXJMT}DlHƹFw-{>u+11m(Cd$`S7̒QLu o|ͶNzWܘϞed:UĴ]>wDZC%fnJR-dFvX--sN7L9Z,%n[Dl][seW'JudbO R%-jF<ɤ%FhSV-m\LWV98䢥UVh y #|lI&?1誈XmVbZ*9W Em^zg̕rb\2)&K j8sYg*5\SǺ9Qm^Zg3'ZH2ʣ- \q*fQG&T*3f2 I*̉c2"IEjDEbĜ+b]#Cnuc9ES N]YqaDskcҾjjc9UL)c%֢237vnI6ζ 2,Tܣ^M6- g^kXRPTȦjaa "Vasl̫KKuVO8NԈҋ!j3RBZUDcb/UN;3Y,HݑV*[m>b @v-325\Hƚ [22Vjd:;λS֋T=:;ر}0^\R$,-||"|A~\c3Kv,ҒI! *d*Öe9 ."R4UpO*+' :m]!nffxĽ;=GXꬉz#"q6)3ns|Ydoˆ7k10e.)7W]tFss`x.̻E\JB}t֦I c>ԟ'[/Mh%YJu۶"ض<{ADo:;fUDM}xo eHR(tG%ФJ4II+h܉I%3(IQz5޵e"*Ǒs.o-28\998S {SXr&զ''ɲ%SkLȞUXuobSEn䢗vVa#ۙO#DUCi{9*R&m+?%Xo2HKcԥeWC&GRa}^X) ƾU++M2F֏g59$tz3h) [vbZ"Rr7"W&@mQy.p+42}uF~>q4vV.)7'角G=ПK~;^.朗O!?1`k;a^z}M{+jMPҕYۀS RȢiYyVWDPK-ײn;Xt!EEqۛibκ9rͅҏCVS›cRYP4LF u8uΧldYް0j܀%r>%WߩNǜk jNDf=Uk&}ֈhŤOm>}"n8Vh~ Nu9VW^zR/#$#Z/])>vtgvS07iݤTXTcvڪ=xFWygZ=*Cɿ*wC먷B_XI0WZQ2nG.ν~`{:KߨxhF7 c3=TX֦n*,*1H"E:DT)3Uq6>k Q9%Ң/若/xN8VՓFK*&%F0-r;t'zȩtУ܁LO˳uçI6tCk2"=^r:~W Xv'*Me5#r2*Ev*ѵӐ\Nޛq3¸L!Pl>Zͤ4٥թF7F3<镻C5'eجG"-Qr|"@NmVa[sb? Uiƹ4ΐpwnJGV1 JRL"H]9\8nUUUUM3p4^P/I; q΁t7"gɶTq̷3?om(̱擬KZdvj[UKEcFśVҽq\ $zM8Tf]\ҘJXRdD䆹¹yS#1&W2x2VtB-$JJ +aXR-J! Ι.u]{m(V11 (׽ʙ*ΈذdN΃ƣS܉iώ{ZZ!Ԝ7ֈ*(=r:6jm2I5*<;o?+MR՜܊CEΉhvNÅ\Z똘- 騮UΧ& y:˭|)wI4jXӚ7Fms#yvl~~T748'&fV&rC_U{+>Y{!ѝF"5xjsiR5;br'n7L\ĉ];?ϴHѧ 8ó$u(VEc6gfJz%^g5*l˭(YbBUkٍUsk&;W[VYn%sdϛ/4zX4masam0I͟ĝ7gؔHqlfRԴLE#Wkb,M$jS;K]:W^hXlGcMk*%ez3@j_G]Nn՚[ ٬J|2?d+#rzdZw rD]U$&)q;ك8cfHIM΍OA[;!oM[W&Vn;=Vv4FdMMbEf)?5tƻ&tˤzֽم3W"&D{3"&d:'D8WI-Joxb*aaY3%oqH3hdhAIje-v7^oeT]:$)X+Æ\WUs6r90mD\ Riծ-T甞$JF+sQSl'5&ꝗQM!xxTo0l,OlOo♚3y ~y*sM ӹJmTȿ FvWOײ>q% )Ya՝Xa\L^O;g+ߧZg%-s~xh(c s0&>_}-R,~"fNy{()!&\?J|iv+qµ3Cds//>ϥ!ʲvt#ґy>/Pw9#/4ߟ1~\. Od?;;G9TTx~bNTxTkv_ؓPnkȧd~x}e;.ѩo.sYGo劧x-q?h:p gitLfKs_!ξRq0w?5gTxTر^NTx_ؓ>ĝ$"Ğ#*.߲ѱ!otCwgbhhX̉LS6ƛ;(Tkʈ䣒r70β7Bp2µL)]=bO6jUץRLʊQS*-3KtƴsW]dg| )%% 591zl GY;@+p\/HRn4U= jŵձs/,ߍ-jWUtf--ժɼȜdeX"ezm{tF̊5G]#("xy[R1r*̫%bfUF[yNϺʚiU{ySomkZUS6;+lɴM7;.Eć0  {p-fdZ*V{3͞Y8S osI(x&7Céy5nj'JN9(qj9}>6q"ɦILm1U2Vnw{UhWJz^1eY2#:"-75*clȑ['Q3W!Yl+ξ3#yi3Y u9:dFHˎ{vsxy֬u-@b*UΕTϑ3"u:ifĎwrM Z\ٜ+G.LT qIuJ5_3ÄTIוqc˳.ͯrjJK(DJ,%jmIx略mXjebaf&A~wѱbUrZSĜSdGD]5wsSk-ՅV,D^{ɴJt`er dVx|B)6lL lGQ6g}[,8l٪q\ٜS>7ܦ$l֌dLLK4V[8lJ덆g1s E#qxaxz]\uhgRe))2Ƶ3Qnvd10ψ'1\4,-&0Q2"mZ>u1UJkҔ_]6w6^5W1huw5!V^'I;ΪS7_ .Uwg+V?ZkwsHv49̘ hFZ'Db9e-ع\ɳ(~0wgFwfX3D*3*;huv X3sRؿHCqWw}QO+O+au//ӄPe.%.W۾{]UMafQYΜYMlldCRZ%IQ) MFFDU;- J˹t\WFUm&rӖs7+,>jJ /"yxbo2[dZiŚZ6mI<葥D.[@K/|g!u,FZZAsX_E9QMo`Uc\܏ (,e> 1%ӉN1x=舚Y$+KVl8lڣ"6#rQ]vf5ETh: N<{.o|*vOvΆbcx<#[U?0/ŃQ$CzFU5O6\rCCJV~ugnu.:+eK46Kf.)u4c+ lTw9 y.)kl vZW5˖X0gfF?~L* o±-3f,"w*Ixea|-RH@44>x zhj#kZ!$3f!4RҬu^%x.ZG1V+r*9UWd:S^ nv9jz y6՗c5UDȉT,00BaѨ[7|QٓӻfJ!l!-24VyH #UTT\訴T^ylN#CEU+M%v>|NXO(QacnH{6 L ȓYc2*itDNIˡ7OHsjU˴wmbZӌZܪqmFEo @36[TДTJƚOdw",qiJ+qEb\TSxaf,IFҙ|gb̾ D3ԧ6{b7S4?O R-^Gϯ-]H! !G;_#˂S6}%,K.K3[]7G?U01N0y9~ݛ͘]W,VJ/ӄPe.%.W۾{É>Rq1a6Pc;=xFWygZ=*Cɿ*wC먷B_XI0WZQ3oG.ν~`{:KߨxhF7 c3=-ÏzFo5<9ᎦpN!'Ay;fޕ7T?1 5>ӵԣ//N..(QxGu="LPd4& Fv6Ǜl $淙UOEUZCXFڢb[TsnXk}zCW-I! ,MU;o{54lXMCT&+J"U[ oYi[rZ}'=v+RX3p]#^r&&S vN iZIi; U4TE*((n؝vj 4Fk449z#[RZ-%"jTZUU:vv}V*Wmv6p[mY0ekUjʋ@'^Y'U"%݋q4àZ51~nבWQ(=8mǙ699&(^EmbkEupJm&b0Ǒw$W1ƪg҉dxΦ83D7$Y)N NI-^Qك@b(rhrRlJ:reŭ9uȉÏtBEvܾfS]X5nGUDT֦Nz0ّa UN?ȔxsA֬'IfUTcm6W̎ĎՈx"S&fi6W2*RtɡyR{m,'ΣuGUhwʉL%->5[%HjFDFFJ#*hQXR*.MʺZa𝝮T햅̀:Us'>8| ;upv&Krm Ԅ)8؛fIlh JYvfq閎\Qܙ.\E|ƙZ ~͗2Sj6^̅gEŹFg˧~ $$TVe1J5(m?%>Mdߚ%'h),i));T-a!FIN5:LT,;?p;}%GUʴDDL|Fv3yC;4f-&Dž2Ե;lXRM-cL{I)KRs܈!6.[=QƵ1.dʮ:;esuǔtQKnpFVL54No)ܬ3#ѳB) G*FU\W7&L޽jEǹ#DUL&j}umJJ{QǽȹjfBJ?"+XuzX\.9_OgvI25Q^ ëQwQ/J:wdoJy̆ Uo>ƎDzΜu8~)EM2\ҷvWf)x;bfK[D%E`ٟ,Pܛ!zleQNmjy9;Kw,ib+UU85k!}閼VL9(*$j֊40ߝYI)є.#ʐŊڒ͝Dj45hV4k^ā XnXʴ˅r.TEZeMӤbIF7 Hk8wSYŕ Wius^vNHZ%+fZUug28sVig lT^Kv\AFJc7̅]Q_M>ձ<Kfh<3I)Qa4'#N/8ˮ?;*ESO" X5N>WlE^>_S^Zk+?4gVvzv`n,ًCI "Q4Ea5#r]Пi^r|(MZ.%b{#!Ja-Iqw{X'sxCMM݃3϶*κG=~Vݰ^e]qx\vFZ&j=Pz>K5kSe\L-G.lrQ[ݐX$d܍JUU2"RLG!FJ=l4d Y4S&KBf%I:eQծVP9TT|%GqkQQQ(EELk1BC>3x6 Ɇ@"L ء-2K`4wQU_M/ xTd|XUsUz]^$DWUrU:52-2!ErYӖS|GCzWUXp (5W>J҆Hwt;% RQ$ci5TiKKJtF#2d"9 bQiV5EN52>B,'*QMZ]&Wi̘^doZ\4 )7r]8b+MB`:FCeRJ2$7ܼXu.3S? LeLt2Hrbk,)2'u獜IZ)=dGwVNwӆnZR*=DFPѶՙ "EUv*T/^E\q5[3ȳ[ ZuĊ&GB™hW1ztyg(]*4W6ƒ*h;neۣwsDT{>e”ϴG+;; DD"kZg|*g{ve,y^Iբ*dMe&"qhlϧ#-I~¡1(i )MدM3Cdd HuvW^zR/#$#Z/])>ٲ%%ޛǘbϧܱznmwq ##"2:#!i(bJ* Oq3jՓ$J fns#ѬUЇ]x%eǎȱ5WJq}v4$lj^jJڭ3L+1aeMqCoJnh-Ϯ%]; d5J$*no)&mI!Fx&쌕Zxs۾RM|TTUL եQrU:tdd]kUZ-UVkEZ2dT q;%zENJ鹔Rf٢4hfG虞TȔLĈW;:Kw #t%RK6i5fIJRUDDCt(nkS*"sϛEU|mrr#c\͙2i)]( qBdh}Xm II(! p$! բy+W ĶQ0-֕)1着Urʹq 58nzjr"ek (k.pZZi^IzYUQU)Eɠ&@#:Tr'833['4YX(D 5V>ԅӲ,<5VV=iU܈Z7hSVD ̫\;FaҺs4K2bˋ$Q`QsGmeʨ3uS+o1QRٙfJDj4űdzy̴FpDՆhvEÉkKkQJTB/m/k]EmpCD^=b`QrvR(ZxrJ1&#8!4XfK"q4vV.)7'角G=ПK~;^.朗O!?1`k;a^z}M{+jMPҕYۀї>ʷ@Hq9Z4Q&V2w&Z)96]D$Deʹ dUm\؈E{R}; X3 iZEZ;{m :U]Q1#\ҵM n摨.g|̒AqnrS[RdͣgGdl9dJcFv]HތZ:T\jrny1rյr"hUDDE[ˑ(?-2q(ڹ{*W9"Ptd&r(\hJ0Fo1Ě26ԂZ Ʃ&*85Ģ"文^|2+HLWjJ?~)jLR$}Da[S4?O P`;>YeymG"?N}~_}j?rG_Hi>b9e-ع\ɳ(~0wgFwfbYrY8!y&9q]E!͋0'w~ldbWy~")q-yuھkOeږ oeW2fsS5:k>RT2շ8ܱ2\߂?pu3J.&GB1X&'Ĝ/2XjLmr6Ze[k^cg\͠%mӧj-P̲*dJ z,y%ҢgdTvG%.\:lhO O}}xj*-muX+~$.ŃV{)0+XLZ>W宵BhkL ݰӴ:nlzaTJ45J*;%(LVa̬XYVޮڛNv8IZ^3+.2U]ܯNv8M/qpjɲ%mltI=^-_VɮDJJѬU/xgذĔ\Y*".u۟#S ՘2QVm6׶gZD%r-rU*-7WwByGwmC1]+r|w8QlN.9 Tcl; G-6NMNN+ȭchEJ5]T]Mמ"L%\̈2.0uGtEWDL s,5L̬XYVCv:b#N* '%,K[\a>T(YɴG!FQvjoB*R2:NXcę[TN5w- rșRTZm:sIivc +hھTʩ\isG2)F%&$Dz jу6%RE!%14vD{Wx6LK:ˇ*"D+1S.]q܀uڗ7x$bz{rSٱA^r_cfEn%t5F"hJ]i5uǎX.L1u*Ej+6w̬XYVv:b N< #2c(meZPj]Zz0 ܧ / X***/| \ZMڌ~Efd7HrO_$m%c7FX9UVQ8S:SI]*~eN2+U*fDLVhs2 $Xb*#U竚DTE̊vByv4OsdptF"nO(s1Z]x3 _RĭrbCu񊖍# *2'i.c2/ݺo>6=2:"qELM;|V]We J w;Sz1 ܧ :D@ݓR.&%(GYF px R'wmW,iRuV*w*/\NZb~bF,67+LΨgG~5~ߚIr$75FS%U&^aARd)(JWA?B!.OXd/":svx\+TnIYK.6j"(Vv ԓD ,A` 2jibу- fMYd-$%V :<}~Z#D\.TET9!ݶpymKg_nUkDT\+EJQ2.C!iY(r`x}x7|'(ãL9"JJY^!nXscQ17v&%T:g$HVVL5ΉR\6)%!hkT•T.UZm҉ω{X[ĥ5nźanw%؍dh']0ҩJbZ&,7tݹr#2gϹV7>֌Es=b8i\Aڬi/]Ѵwߐ YܽY*S`v~[LP*З*><CBYFM0IՄ!5e<'vmV#S6UʴuT{cȺf$8qjv;.1L: ssGu5&܈Qet6~F8GbRUJg}] n-YDNU6☻bȮ u\I>$kJ'%DiE b[QԤXb Y%i#JGZJo WVɨJ1G*9iGQZ\$h%\.cޞ(;l$-e,U\R έ9%X)ΦɲGІ).Z0U;C5cQRU3MgUն8W=Ԣ+\Z"Vv,{ԭ2mW%UWJ)F#*UUUVUUW:f$8ܚjՒ1ʨ,rʳu3ô^N˘d qj1M1avdr*MRF扊0()yzbJh'YRèʲÄg+#dKKljգRkQvj|yffbx{E+K)vxTd5 %mQ(UjseezPʴ캺joS:̀=pZ^wb龀)gK6[â*ykS7H>Z{E b,ih8 *Dj!uִؔb6ڈu1^XIg^,\ZOZL1bWZ֔ɟk`F#'&& *i.eI@ quY7%$exMWQ!udgNbXRjʙjxݎUQvsQ=T.֕vrkpLâЧE3+.2UE뻝NlaS=i{kB+."P>c*҃/ulDU7 =p+k.J:f&G"B(c}JRښ yVx 9̴ȇSknŻfQW֋T*e)W'Y]r50]?Q*]ܐQ7uV9Q3YIKh}$:[jԏn^"aJW1SFTL->=aUS,j%uu['/)\Q! ̬XYVkv:bN* #2c(meZP:joS9{i{kB̬XYVڛNv8GZ^3+.2Uv:aN֗z&.˪i@뻝NlaSu #2c(meZP:joS9{i{kBۻnj|c/ 9'\o炭U^XGE~P-{eŊ[D\WmN\Nu GTN5ӗ)5lJ^VCתb J"EEbǦ֝vU ضb$-iRŤa7iyEr9EC5EEt8*$6.{D(+S^IRo̊p0sv0RkLnZ&UzW-v̙t8E ̈E*Em+\hm.%0AwtU2^)BVFb9 9^:F2 Dp`j|X]M]4{YʮZŅ2ךd۷7w&C'iCGCν6$M5ZCS]ɔ'bRGfFdlaNd.fYDf%SHveTyvU59 1HF"*Q*"W//];aQ*SeT˛kIĺi/]Ѵwf^xN)"S`v~[L QE!j?^[-nIhl*JHi+F-9yj+mhWlnjP̈*ː[Zݻ2YcDJ ߑr5"e\7hg>9);6αᰭ6ɫTٱڢ:ja*<7 [MƻEN7iH|N)KŢ!C_@@@@ endstream endobj 19 0 obj <>stream H0aqUq=pGQԑ$Mۿ45GkXSZX_Qzi /kޑyFD̿ -17D1y W4! IɈH`P]}HRGcD ߈ݮ {=rAo݆--# N( L( ùX͢3$wv`O䍠 endstream endobj 9 0 obj [/Indexed/DeviceCMYK 71 20 0 R] endobj 20 0 obj <>stream aQaW^R\KZFR4M&d_D PJu$yt9C1 B5 E "% RPE =: >stream no/k0\OgBQPaM|^S#{]U%v"p6'keS%kaT%f+%b E DV]D>K\; 92`b/- '/$&X:&E/&9)&' &%e?%N3$|N#pF"z"l"`"V"Ni!Ԣ9XFf7(8> endobj 13 0 obj <> endobj 24 0 obj <> endobj 25 0 obj <>stream H TTW@Uwq[qbtQ13fAG% DdbDQq(nq! [<̙wNUzw{qcR@~}Ԏ놄}=qzr@[GĎ05aDdeh"Æ_|C #}1QaZDD%]3, ~hG%֮6>:,:;~.)!6f\7d|[*>Ǽ$i!.3Ep`i ɢȒYMr)=ɡ/O]{=&g,ѫ 2Ѩ >1*@,$f26J])^JJtT)=yBJSES:*/Ew4*HPnזl[f˳=Ui # iSmQP+kZ^Gw-Nzg>ݰ֗Τ==a(:@6N˘6ϳ6jeɛݝܝﹽ˫=5k<^i_r8ij/2~r<ۼ\`~b1m]骄R?qTѠRli|[Z#Mzj^RqvC+*u_"=_&h81 qh8aFwA]xWw~Iפ۔޾~QtMC6RJr{ \VDw1ِS+vx*|PW_3ljE 2!fއpfB+`kc:|k 1lʡ2`0X!3p\0Y(iv1\Pp`DC41ƫ2A՜39ɣ84p,<8s'ȓx2O$N*ȿ4Ωܒc#lM0b6%DlmfEovmwhlx;.1[B.\}z>%@jGvG /E[\iW}\ॼ2>O>紛>ݵEŴЁyuotБ\ɚ:Fj8LcX¨(G%։tNѩ:Ms5O יZѢhq$&aJ džiaz8.3ìp|8!'0'NSianNg̰Gc&c i㢷031 Ɖ3|oYxA40A)R:eDSy4fGTBi)-w=Z_S%mIixã=@(wx?g>Ocx?OX'NV]-NdZ $3'ImH.ˤ4Ғ7J N.+j\'s(7-r/w=tU2yNzP%}eB !ePIddɕ|-1)EYJeRA?V*Y-ke*,[| d]Ÿ.\vgG4~9 |%_7rX#^PΏEG];Vݴ'΍A͘;8?WkpwWVk=,[5ڲE`d"X  3L2i3L:dǴ-N2N[i'̔ -JL~8-ɴh9qw{}f*wJLLɉzM|BӠǠ̋z`9cY9 r66@,NuTUN5%33yF|q!Vu1xPW:gy4) y"80gݔ%<&ȣM 7ىq]5 4:2 ˮr6JdoKIbrvWUV#I`]'h[J=zP~_!){L/{Hǚx磞l6I9IYL|vxz\y9?; NޯW+[l'1\e& &+2[d}V&TWWXU/p/tv`EC &nVLV6c 1ܸV*ptp*GqV -s[n;kva(ɐmC̞Y3rfaaTXp&-0F%|/~ _(h&⻦1wPZLf5z\X 5f9O9)6b;p; ιʺʷ*ڵQG;ѽQZ/>P#a}I=v;NJ6XOEJg:`!~[?&ñ#Rd J?-À`FJ*Ue?KH964K|^:=wwz3=Nv[_僧䐺=;ZܵƳYks`Gpz-7~b#w.;#:Н S( S( gEf)T+:m*5;7L nЄo %b}-go-wwP7kzaR_hT/ ut'"m!ꊖڊ[[  f *0_3I Pd >G2Ij>9Bj/:S#4Q1pP!&'qE0 V"HQI0B ٍXK~鱍Ϗ(=9KOOuo:VÍp]n|tDw5- \DŽcZ & jY^7Py3Ua7m6"4 .C Wd7f`^ jspE!2AP0fp (Y<_u|d+g~q]!t"a[5]Q%ʸknu]qS+eI:^ 0e#o~Hš+1br(qU1p^MW~}8~^;/'NbrS_ᕄ0i3j`ؠ][N 6mmQiejIhHVBAY$$&4Z}kYV]9!2DF#c>d/l7r1zr b^5 Ղi!.$K5^gׇ>\㭣O6oܼi#:>JJ7o2=o4&hG'eT0o6o[YlZ$*-UY)5g$>ٝI3>H'LD^׷VǼ4+*NI2)jw+j$m=/ϼdպSTwr7/㕯Y1Wa2>o}4Z>TܰY%l,1mU=:)xŢ-b-> }FʺVʺrls09ROI@pb .0<3l /gHH$p&fҰHLy).%EcMrEK4%"R5 jPnWSX Z K v>9zͺ '@3-lICgu8i~og@Lupf=jW=쒻XQI1,~ xʶ-'N^ٰa,9BoRVdlp`shw]U2[CE+ ">G;^張<i.p>vO7#hRQ5#Z^ܥ:Xbl |8yC+V}Ǜ6Xu5{9diy?Il, L*o BNe4.<)7 '\WKsknJSeFZG+r,e;\"q< 1cud>X/q,s>C]sGYpYd]z."X0u$&Z3de8''0v GsP`SZ.xHRVZ/qG7];7ipך#LAH5ֲs'-?RտOH=][qaV=V9?#.ŤȋIEu쒗u$CDˀ[ ! /Omv.XIfotNd $6VwnlH nYG}ht8Ζ߯lGm!)Xf`CPiK=ݏIآ u5ƹ/<rӄ'h_4 EGW, G,X< g~Zx007/;N&Q>;fs)U6:߆-c4>6xiWr̖5#h84 ]'&KDb[% YGI F5C % $P\{\hB(6S;pP`<ی@W7C:<{)"G Y4 @cDM}Ywfo*N̪3$BQF'^E=8{}fawI7a&fIHْM< X$@Qh`A`46*Z2NĴҎ %ADLc d|{bܽs;6m@:fShE-[ˮ:{z{gom([251xڧuߚ<_ 1퐯V0KeCv]4'YyPEUXTEUtEfU rp>IlVBXtUzj}S]=S}3jYd{svL/ R~HK>>>>. }t eH[%DFe'-7y8}?W\޹}Ǯ];~K.M~_RU'O?[>S;!Pa^Y[9.Vbj!uiLʪIfMY{,,٪T eE;>&vLmP4&zb(Us rIgXѴ&*kv?811)[ZJz^gȸ[+PT4zB6,nNi OJFy\Wb]PZH3ij#+#4c؜kb|`5ƴ76T2Dȓrs`fByAx]ckU_xJZGK=hR-{8l+n yVjP\_u<۹d hqp.Z¸¨CPoOhBk>r^˧lb#r(FGi:˄@)n\@VdyV:{#󋻼ҁo''&Mݱ"nŅ7SI}sSZQS%FQcۺF4L4g:'?YZ^If.ɿUvB&G$T)ٜ'XMJ ATW ژ6lR2ۮ9Ykͷٛӷ1ڠհnܴ9=߻ɲͳ)z{ۧ(ܹ>=5@?$&'S*186յԱܳ&uN))<~^c8ɧKIU/?Ndv&K!`8 fi%fyEx,J Jbc]Nkk(5))I*$]scJqna=@\;W!dj#ɾmZfe^hnŸT,-7+ojOt.*XgmO>G,15z^Р,Aہ9AHY`݄nu֭PgV}LF j`=| $0 he.oy&j*B8^S)gvAqU=<j9O>o8^U v t̞8;>8JEb6bOǪہ>@: !|6̃,@ьX~-k|dj2,?!Z;L?k׆_#>ooz+~ z)߰1 'KdX\{+ķq=09VSfgI|8b7/3hj LrwZՔsZw* {n>uc's_u[! ۑb,b1dx<3"7R-|\+qFpP<|F?cqu!AAE"~ލ1lyO($^jOZO-Ƹ l%˶V,-gkXT)j-{ EY^Cޥ m/peeԺ0'aҏB {&w]\ ˁa<Ŷ98%qThўC; ZezװduyEupK=/ٌ㧺ԿQB1n0ǩ(.h6،xj2jUQK9䰭;Ÿ<8> nkHmeU95^u 봎wbZSRH_ O#iF0ٴhs81]$@OOd<9JmOz1vWBcoObcR b?8#cr=|ר gԪ %NЉrCR~t喞Z->s~;?yZJ8[lrṟ\"eZ /MZAx8KZ ekc;0sݚ`ϡNf}) |s?-ҠE£13^Bħ{z3}ߝ+F (7?(w"W);({/k3fWy38 S#Ev3Эo Rnc]s , ]g }iT{x. i胻5l)hwQ1m[AX#yD8mO7>~#&N~ƺHپiALw94L:,K\}4äW8{!KϢK1 f)P6ޛGʊ4r.޳>ž6;9;ٷɟ#˼<;+Ae)WWsu |uo|uoac_M7PƧ_T>EcFO9?KƠzkUW*E\ vKf*sbi,/|~!3~H 4`>eR]Sfu ߐ7$Kw AּƮR@!?%OZoUnr\YiEEb>lEHgOj؞ fh51L3>䭘~,g5ޜo1gۣ:Y4mێEٵȶϚh>-۹ؘsWlȞ1ɠ2:h=$T88Xw@fzO:\kc濩!6aG.Y-AlfkXL5.o[Kd1e0o ؎OF4^Mh$Z F60.v2Wʫ9lw? !o6M}Kk 6S{x+fǩ q n7T5ʒm6FAxaxԜ_9sTݣ3s]o"zɛiΫmf Gi[OqC*tAml|#5K@."߿^Ⳗ=A>#L1@2^LvIww9Lk}1苗dHJMߏﻞ[x+S?-c S?YjCy.x {NsVgCe\:oga$AXͣӃ:-M}HZ]@VH8ȆÚw:MB =Z*Z4>_},YuRw-4$~96:EPڭrT7̹Ot]i[#b?e/sҮ\z{̔NG2߶lF 3gK̗LTo! vI^$3 ķīmw_,"#Q_tNb5F$eű|NR - "iP?JK}{)ձ-tIK<vj7p,=|c=)}4_sIS͚ށkܕ )9W!s&B_MυrM?KR>(5ʅv}P>? OiP>3s #NP>#wXhXOU0|N)ޤZOO_ѿO"oƞ>6_m M^. =tRVXl&ΕlBga kwfl#[[q<ûu &vQ_5&-`mvE]Ćs]lZZ䇨GײalZ7Q\(^|;л bAm7|f3Qy*y uP# Њ^-:tƻ3Bj6qo;Ϡ||2=w0f9ChQȣLjp_Qa~0ֻxt uj݃ڹ1mL"/6ZXm«_Tm:dhw#8ϵQ`yJ6rN1LS܆Fr)C—p6atԫvz{VF=a3O;9YY} H)[Us=}3~_0A}/y_}\x)kJwkL,9,'%ܩVÓEr{TM2PʑKn'D猺w^,O!i9iy-J]>!?HWdSC:o u߯:uhL`ԅaO?O+|>]T~1PK#BLyĘsQV>5xj9Up)Ɵ Q[)WR`i38&9\8^cE>^;d ?KcGkU5}YL5'%X8]~ތħ򞳒qL|Rtԝ%n'MF  5AN{eTxGz'A&&&;{7їb}D2**!}*cܦMb gڇQxaEŜI㞨9zyC. ESRTbOIL3qsU󱔺oI_Y=z3G`&n|UB+UE65JpP m&^}S#ڢܭ72w3F<}82ẇe;Ac8 8>d!jxj;c1 bºn2b)։vH(DMvf_:;#HW ]*dJFYIdVi1,Cj1\"_F2Y*WS䖐.!]o-Jٌ̒>_FӶY'IQiw\ umKHWR+3fZҔːu 7+>'mL+j2cjʸ8MfmMn4br]i%0Y''ltFn~'&Y%WV4w{^ŤNsgWpwxArz^o KxB)G;Y+~30_I#|FO; }p}~Yt&m0ב-ZtyZqE{q,,j'e}!:&QL]*r7ْd׎F9rLNxs| R^l)TrqPZPN`ޮ7y}3o޼ѓF\p&.r<`U"QBtU<\Y݅ӽz9n>0h,89tu:e[mk$T3HHOcYtڃQ6lH!j&/)fL@PE|bCO@Na A0Ivl&a,u*ĩ!$Jd8M1^|{R@WAd{Ž <<݇z 4yE3"3Ym2^md0.+7S([j OvNӝQy:y|< 6HI P1&gpV?s> endobj 23 0 obj <> endobj 26 0 obj <>stream HkPSGo7.//Xn"B1FP J"NUxͪUkm k% 2Əg0&dtaRTȤ3Yl&eLLSdlLF?ɐk*TU/Vƌ1 FE3ʙ,P6CvT#+% C飌V(W)߱r O`HBT@XLB,&D($ MHԢv"DA=HЂFaq_3XQb';>,5pF ss Q. 5PȂ({.D٤c{Cs!6-X.b @ MT09v/%D, fuaNuJC]EpHҞviawڵa8:s߹R EZ̬)JگZv Dxz&yl%:=nlܴF0J5?C0Fk4vmI&W`3ퟋ4tN d·IW!S̽IũmYNo_q [Gھgϥf׊J ӫ L,9KH Km6TWITRq&jGi!^OxVNK@<ޗFvxu!톱xT> B<)LEҞBu+[\fJqDKq??+KOG9't" }}V yqG@)AոmӖ&Z&HB'N <l+]X`.Cz %o-GTXr ܶ[:S6K].Ɠhڲ{Dgpyvp 5]MηpQI[_WC3Q?^a)S﷟>{L> endobj 11 0 obj <> endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?ABʰǶٲչҳ?鰪,BCD緡ѹ)HIJڳ;NOPQRܳշ0XYZ׷]^_`ݻ屷𷡴d(魶öڶ,O;IJѰİıʲā7ҁӉ۴Lj̇~ͧ$#,<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->ʳ[aل;¦;䲹]h-֌ՂgOںRs2Тy2Ɯф-1჋Bӂ½5-݂R#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬,)x,ٶ-1ԑQ5Yf'g{\ڵʰz7,ѶĴʝ(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>dψèaCԆ='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~1ܣo8#϶)Ɂ.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?G<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤo°᚛䈳5앳#]g<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>沵魱ʲԩͷ97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>°ٸ4>籫>*<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3s(ɱ1V6IȋƲֱʲuz屹֯wbxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚ龢΂M⾱ԾƊհ*,;߉aƴ6:)臸虳z<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>ɸsܑͳ~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>r"ϔG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>7=r7fl5<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1к#i<7Py)瞟mߏb\4cVNJĊQ>䉑x1+?#ՆŌWXXґyРDZ.>=Ӭ,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> 汷@Ԋ•ǩχ贱q~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kzp|ճ󁓴VDk~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"4z*pc=𰨱9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>¬aɟt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"5ᣳ}-&O#ʝʘİ<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XR:̾(?˕7.ȑǔ%ڒ3ύD`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-ڱ3)%-fIhϴwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~܃;dyv0;wkRxmDyڴ6&st氭ᱹ5,ٲѳku=Ǜ^v"L{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~p*t8tw(z_iΉkbmՈ.ʇMq݆l6r*ssݱ,y͚v˰&ᗏϲld›m̍³o2R'肋6˸*≩ٰƉuՆɂijܰ²֯a!noЫ=6*ˍ#uՈٰf䞲h뜆`jVгҘ˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#۶4S醄98"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ܳ6v.ƍw&͂x-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>ڲ԰0谭yՂ˴ܱճ]ݳ`ڳ{՟bܵHd|< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>|A<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>04ٴ)ikęm6ⱹ1ϿaP/ѳ:ڦ=|h4찪)}m&ȵ~t;ʱXyOyjʳ=m3{ǣ)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>W0"\ev"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>۰1ѳ#Ytb7"< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>6蛇UǴݴoڰ_զaԴrNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)ձ.a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?ABʰǶٲչҳ?鰪,BCD緡ѹ)HIJڳ;NOPQRܳշ0XYZ׷]^_`ݻ屷𷡴d(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰ҡWסtܒ(ƒޖ紁ܲhO۳ێi)›=0$ѯ%ƭ.={ѵuҴ|Y^#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>v{ѐ*ϵ܍|<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +yȤ!˿;ʨ'*ދ眃ٳ؂y+9қၼ݃ˁ|?܍bIO?;ހ~)ijẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽Iʠ>:铹zr{=w{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx03nj)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(a<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>q茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->ɸ铭Ұߑ<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwp00K$*⇧ϳ".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>z⭄˭ޅ݃7ȸƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?ڣ&$fԇ͒;Ն:p11'<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!oԮu{;Oxݴܲ}41}#ʲopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> ܫ0ɳ$2$ҳްnվkyʵn'|ڴrL}>ټ=v/?ʱճ!̳!nꕳݲ蚆yr&'izuҴ{vL;=y/{!~ͯvڳܻwwwyҳyz-{ϵ=.|}"~ծٽ~7%ܢ~,ʔ;ʷuw~gx۰ڲ<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ ܷv.ܱwx/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>ʙFʥ~9~:,~!ʱ=y=󃍳{;|𳧏|ᴥ삷9,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fڌ<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-H²4ܑپmܘXαO#/F63=3燣{+.8"Ƅ~ڃ5Dzió40W{N:Ɖ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,|k|Ÿm}³󰪴Dz[q9"ʱuʳ6~*-zɴڱγ烸jԃolڃ)ݲԳݱ1賢rQٰ6-*dz<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnDM盱Fн?E81ǰ*˧#"ܞxٵ[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>ٗ7؏ձ1(*$ǵۆ~YղtܳE> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGص"Ԍdꁫg)1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.*&Äܞӻe鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]4&uͭ/<~B5m~Ys.6~pS'e~> 9~۸22R%J}(}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>~W?ɴxձ^y&ۡbIJM'ڲѳ@j4m|)}u7̕L}Q}/۳۱ʳհʇXa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quz-븿ٳ󹃵°>ǵhf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7ݰڏ%-ϵ[C<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeoռvGbճ<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>/׍rʬpSYǹ^s<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7f49j*x,!z|ⱹ;VϴYdڱϸQ(GǶIJ=˸j3tݲԳ*vq"9ɋac`cfijhڲѱʰim=3q*ut"2ɲܳegbc/YkOijn*1pky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?ٷѰʸ鳧³ݴܰڳ᳾DZٱⴥʁ"SRSTU~ߴ{WyYvZt¨¨¨¨¨¨¨¨¨¨¨¨¨¨¨¨=9",77侱ѳﱷMLL}NxOuPrQpSnޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮlޮ8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=񷡰ʱ볧WVWXZ|[x^uasesjsqssssssssssssssssssssssssss9(.=%7>>ݺҳʨ쳧QPRSyUuWrYon_mdlilklklklklklklklklklklklklk;#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hx´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>´imqv|あǨǨǨѡŬ|Ӏσσσσσσσσσσσσ*8&>±mpuϿㅁనyxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&=»mps㋀޴yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&=³lqsx~޶Č{{}ЃȈ˰˰˰˰˰˰˰˰˰˰˰˰*9&=²ڇjosv}Ꮓޅڰ}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&=²峾iϷmquz◂ٍЃˁɃкϴбббббббббббб+9&=ݸgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&=ݳհ屹einsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%=ݰ幻insݳvʨšù̯ө֧֤֢աաաաաաաաաաաա+:%=ݱڳղhnظr̯x~ǫ́ԟכ֛֛֛֛֛֛֛֛֛֛֛+:%=ݰܲholҽpƵv{­ˡӕڑڒٔƑƑƑƑƑƑƑƑƑƑƑ+:%=ݰ۱ڴijkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%=³ݳܱղò̾ӱejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%=¸۳ʲԱ߰bglp¨Ȋx~ҥzՃѯՃՃՃՃՃՃՃՃՃՃՃ,;%"23˷.=;ٳVTVW{Yuq`oenknsooӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?")Ű%3'@B]DZFYنWJVVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!1213Ѱ4ݳ68:԰tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8ېچ紥BCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89Ґ9;JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>ݱճ폲膴LjʷɒֲܳԈlnopĦtƦƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4=ݳջȲ閲㏲ԃ݇wհγܹqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3;Ѱ۳좲坲ߘǴ֎܌΅{ƴv쓬uvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>)䰭,0369??=B{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[23ϰ5ݰ9f=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T=Z<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?,<<0>:4?877;5>3B2F1J0N.S.U.U.U.U.U.U.U.Uib[+"\7/c?:da\ݴUOJɱGrFsEEsEsErFrFrGqKqOpSUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:da\ݴUOJɱGrFsEEsEsErFrFrGqKqOpSUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gdѰ_մXQLܱHsFtEtEtFtFtGsHsIsMrWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<CIPW`>kVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNSXLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|ձiXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>Aշ=:Ա87P7P7P8P9P9O:O;M?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K4J=EA峢=;:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|/x9rնkd^[[jЍj\j\j]j^j^jjj`kbmcmdnnnnnnnZWgs#}-5=!탶)倳3{=uմfaܰ`ʲ`oo`oaobobocpcͲd˫eqfrggggggg[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?4<>==>===????????????B9$;(@*C2"E=+D4@;=հ;99D89:C:C;C;B@?@@?@?@?@BABABABABABAC:#?%D(H1!J;)I3F;Bڴ?=<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>9=:=:=:=9>9?8?8@8԰7Ԥ7B6B5C5D4C6B8B:A;;;;;;9:BJ#O+P4N>&K/G6D;B=A==BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>YbԴzʈ?ʘ>˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6";&9*8+8,8,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>ٯEJ)O3S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">$>%?$?#@#"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>kh𳢅eςdնĻմʳWWXXɻXYٳYٻXٻVٻUٻUٻUٻUٻUTdn|#2=~{'2tv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>dmyңң?=A>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>989:;;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:Xn>X?X??W@@W@W@W?W?W?W?HXahlmo&p3m>if(c1_8Ӳ<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>|$y.7ڰԱ𰿱ղٰ³ʳ۰YXڰXܰX۰WVUTSSSS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>Ҕ=;:9ْ:4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pm#i+Ĵڳ39ɲ>ǷԳɹ嶪HHHHIHGEDDDDT`krwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXڰچ>ڑ?ڞ?ڬ?ڽ@@>=<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>=DĴʱ%۰,յ38;1>1>1nyԒ$/8?܏EJO"U'ҋ[+ًd,n,y,*)'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >>????????@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{$>#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>#="yq!=y} D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CCBBʵܵԵ<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>!=!= ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>ܠ=ܱ FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>??(>1=9<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>ϴʱ󰿰ٰʳʶ?ʍ>ʜ=ʬU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>>>>??>>>==<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>җ=ҧ ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>ⰿ⳦ɜeeʴٲ²ѱ2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>>>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDf%/9)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>.>,>+?*?)?(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>94.*'$"!%,3;9<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>Pbu°ѳ6+"2FXkҾ=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>Ѱуѕ9:;<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?ٷѰʸ鳧³ݴܰڳ᳾DZٱⴥʁ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=ǷĴMϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=ǶٳűϱjȮǮǮǮƮƻƻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>5ʴݡ_ѭtǬǭǮǮƮƮƻŻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>4Ұʴݡ^ѮrǭǭǮǮƮƮƻŻŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>4Ұ¡߳]ѯoȭȮǯǻƯƮŻŻŭŭŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻ1=3󾱷աߴ\ѰkȭǯƻƯŮŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻ1=3¹򿱷𺱫ӳcȮ~ǰƯŻůŮŮŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻŻ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>崡ҷɽщS[^_`aezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6Բ@AʳCaE\IYMXRVX¤dUjUU|U~U~U~U~U~U~U~U~U~ܫڸ+3!22357ܷ8:ɴAEHMIJQıVı[İ`İgoqqqqqqqqqٰ"&',*:-/2ݳ47:鰪B>E=I:ҳڱǓ򱹳ԁhfghmévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9ڳڅlϷܛ슫䙮hjqx¬yz{||||||||||"2)=7kr봥熬田mpϮ{¾}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0?ADĴلVNSÉR]QfQpQ{PPP񡿭񢿭񢿭񢿭񢿭񢿭񢿭񢿭ѽ,24/4>46°8;=@ܱDJPV]enҵ"')+*8-ٱ02°58\=c;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTj]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>:᰿8ɸ6T44̾4U4U4U5U6U6ǥ8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>AGհOڳZչhշw퉰ڶ۰ﱳݵͳյ¶ڶڶڶڶڶڶǬ&-1)548>;AѷIϵR?]=j;z:988ӳ7;61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:.865<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>7:>8654G5G5G6G7G8Ҥ9F9F:E;EDBCEEFGGGGGGGGGGGGND;$B%E)G3#H>.F7A?>;Ա:9K:;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>RոXϱʷa²ѷl۰zݰ´ձǸϷ³ҫܱܱܱܱܱz؋˘)4<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:"8&7)6+6,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@'>-=/=0>0>0?0@0A/B/B.C.D-E-E-D1г4B6B7C8E9E9E9E9E968BJQR&Q0N:I&F.D3D5D5E5F4G4H334H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>ٿ=;:979=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>D'L-U0a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[X*U1T5T7T8T9T9U:U:U:U:U;U;U;TKW^d˵ehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\Yҹ>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;Wgd'a1^7볦<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZr۩>ۺ>>Աղ԰շɴնĵՋBڱ՘BBBB@><`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>ݳٰհҸ챹ʰ°GEѰDBAA@????þfqx}~~~+6ɶ?ʹ촥!*汫3۱:ٲѲٶٳCô@>=Ҳ.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\??鲹>ϲ=Mg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>ʷܰ$ʳ+03ɴ3ɵ2ٳ0/-+*?+=,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I ɰܰԳݲ$°)հ,𱫱.00屫1ձ1ڰ՚1۰թ0°ջ00.,*ո(ո(ո(GWagfecbcef)4<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>$="|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>ᴳ$&䲵'&%?$>"= of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>>>>>R]____^縿#-ճ6۲< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>=<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$=/<8v<@ s>=<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>ڴݱձձʱᰨѱҗҦҳҹHRRRRRPٱ$.6ղ< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863466*636<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>==<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> ʴѱḿٱ?>Mh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{ն°zy<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABɰ԰۵նʷ#+1?8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>+,,,,,,,+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>?=%;,8369310.,+)'&$"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7!777776654321-02345556:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>=====<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=357899<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>>====<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>᳢Ұ٬?134=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>?=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;:8776432226>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>('%$#!!!!"$<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>??=96655&(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>ϐᴥIٲMOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8WWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#0ðαʸճղҰʳisw{ǁzyvqqqqqqqqqqqq%.6>!.ɴ=ױݳٳ۳Ѹfjosɴvz|utrmmmmmmmmmmm%.6=¶*б9ೢϻ߰²ٱՊװfjm~qsxponjjjjjjjjjjjj%-5=ʰ&ڱ4氭갿շɵۈ]adfukukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?B=E*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ճAոEJP쳧V\ԱcǰjԱqԱzֶ$(+#//2958MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0H=K97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>f=p?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8J5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*Rd=q<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|eձvkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;EMVչn|ٴ䰪񛴡񭰪??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6E9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&O8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@''A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"E(A-@0?1@0@0A/B//C/.D.D..E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?VjϓgՏf܍ed]d]e^e^e^ނe_fZgUhQgNgNgNgNgNQ`n~Ղфȇ2?!|/x;tչpʍl‰iǰhɳggbIJbʲcccⲵd_URRRRRScùz؁ц̈Ë0=,~9Яڶٵqڰƒnfggghhd^ZVVVVVVgs}͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZo=ٹ|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TW԰WWʴWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>'3X=ʰǵʳڳݲճٳܳܳ۳ٌdݳܚc³ճܼaձ[ݱWݳSݳSݳSݳSݳS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Ҧo>{>ݵDϴI&P,ҳW1ٳ`3l3x20/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;Wvѧ>?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:if&b0_7]<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@><<<{x&t0q9԰ܰ󱷳ǸڳղڂUڴڍVښVکVںVVQLIGGGGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>Ჹ󴳰ѰܲNݲN²NղղLղJFճC³@³@³@³@Xhrz'4>"+4Ҵ=Ұ;Ҵ:Ҵ9Ҵ9Ҵ9Ҵ9hvĀē)5=DJ'݋T/Z6шa;i=t=҇+>+>+>+ƂǢڣ)3< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?Lj=;Ұ:ұ8ұ7ұ5Ҵ5Ҵ5Ҵ5boy'3< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nz)4< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" EҙLRZ>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+,-..////00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>۴ڰ#)ʳ-Ѳ1221Ҳ0/.ٲ-,䲹*䲹)丿)丿(丿(\iv|{ܳ+5< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>#=!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>">">">">"gotwxwqԲ%/ճ7۰>ʳҴڱ"ٱ$%%$?ڊ">ڙ!=ڪ mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>ڕ=ڥ<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>ab;9Ჹ876543210/..fov{dzճ!+3:?ٰ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>ϴʱʳʸʱ?ʂ>ϑ=ϡV_;ձ9հ8ճ7654321/...`iotvwvǴվ)18?> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>>>>>>>>>==<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\